rs1556056154

Variant names:

• chrX-25013536-G-GGCGGCCGCGGCCGCGGCTGCCGCGGCGGCCCCT
• rs1556056154
• NM_139058.3:c.426_458dupAGGGGCCGCCGCGGCAGCCGCGGCCGCGGCCGC

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP5_Moderate

The NM_139058.3(ARX):​c.426_458dupAGGGGCCGCCGCGGCAGCCGCGGCCGCGGCCGC​(p.Ala153_Ala154insGlyAlaAlaAlaAlaAlaAlaAlaAlaAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000142 in 706,679 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 22)
  • Exomes 𝑓: 0.0000014 (0 hom. 0 hem.)
• Consequence: ARX NM_139058.3 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.53

Genes affected

ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_139058.3.
• PP5: Variant X-25013536-G-GGCGGCCGCGGCCGCGGCTGCCGCGGCGGCCCCT is Pathogenic according to our data. Variant chrX-25013536-G-GGCGGCCGCGGCCGCGGCTGCCGCGGCGGCCCCT is described in ClinVar as [Pathogenic]. Clinvar id is 473011.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ARX	NM_139058.3	c.426_458dupAGGGGCCGCCGCGGCAGCCGCGGCCGCGGCCGC	p.Ala153_Ala154insGlyAlaAlaAlaAlaAlaAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 2 of 5	ENST00000379044.5	NP_620689.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ARX	ENST00000379044.5	c.426_458dupAGGGGCCGCCGCGGCAGCCGCGGCCGCGGCCGC	p.Ala153_Ala154insGlyAlaAlaAlaAlaAlaAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 2 of 5	1	NM_139058.3	ENSP00000368332.4

Frequencies

GnomAD3 genomes Cov.: 22

GnomAD4 exome AF: 0.00000142 AC: 1 AN: 706679 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 214469

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000159

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 22

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 Pathogenic:1

Oct 13, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.426_458dup, results in the insertion of 11 amino acid(s) of the ARX protein (p.Gly143_Ala153dup), but otherwise preserves the integrity of the reading frame. For these reasons, this variant has been classified as Pathogenic. This variant results in expansion of a poly-alanine tract in ARX. Expansions of the alanine tracts in ARX have been observed in individuals with ARX-related conditions (PMID: 11889467, 17664401, 23246292). ClinVar contains an entry for this variant (Variation ID: 473011). This variant is also known as c.423_455dup33, c.424_453dup, and dup33. This variant has been observed in individual(s) with X-linked intellectual disability and neurological disorders (PMID: 19507262). It has also been observed to segregate with disease in related individuals. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1556056154; hg19: chrX-25031653;