rs1556863457

Variant names:

• chrX-53250972-GTGCTGGGCAGTCGCTCAGGGGATTGTTGGGGAACTGTGTCATCCAGGTAGAGGGGAAGATCACTGAAGGATGTGGCTGAGCTGTCCTCTTGCTGTTCCTTTGACTCCCGCTTCTCCAGCTGGGCTGACCCTGGCTCCTCAGACATGGGCCCTGACGGGTGGCAGTTCA-G
• rs1556863457
• NM_001111125.3:c.1436_1603del

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The ENST00000638630.1(IQSEC2):​c.725_*122del​(p.Leu242fs) variant causes a frameshift, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 23)
• Consequence: IQSEC2 ENST00000638630.1 frameshift, splice_region
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.58
• Publications: 0 publications found

Genes affected

IQSEC2 (HGNC:29059): (IQ motif and Sec7 domain ArfGEF 2) This gene encodes a guanine nucleotide exchange factor for the ARF family of small GTP-binding proteins. The encoded protein is a component of the postsynaptic density at excitatory synapses, and may play a critical role in cytoskeletal and synaptic organization through the activation of selected ARF substrates including ARF1 and ARF6. Mutations in this gene have been implicated in nonsyndromic X-linked cognitive disability. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]

IQSEC2 Gene-Disease associations (from GenCC):

• complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
• intellectual disability, X-linked 1

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• X-linked complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• severe intellectual disability-progressive postnatal microcephaly- midline stereotypic hand movements syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0584 CDS is truncated, and there are 0 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000638630.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IQSEC2	NM_001111125.3	MANE Select	c.1436_1603del	p.Leu479_Thr535delinsPro	disruptive_inframe_deletion	Exon 5 of 15	NP_001104595.1	Q5JU85-2
	IQSEC2	NM_001441092.1		c.1436_1603del	p.Leu479_Thr535delinsPro	disruptive_inframe_deletion	Exon 5 of 14	NP_001428021.1
	IQSEC2	NM_001410736.1		c.1436_1603del	p.Leu479_Thr535delinsPro	disruptive_inframe_deletion	Exon 5 of 14	NP_001397665.1	A0A1W2PR28

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IQSEC2	ENST00000642864.1	MANE Select	c.1436_1603del	p.Leu479_Thr535delinsPro	disruptive_inframe_deletion	Exon 5 of 15	ENSP00000495726.1	Q5JU85-2
	IQSEC2	ENST00000375365.2	TSL:1	c.821_988del	p.Leu274_Thr330delinsPro	disruptive_inframe_deletion	Exon 5 of 14	ENSP00000364514.2	Q5JU85-3
	IQSEC2	ENST00000638630.1	TSL:1	c.725_*122del	p.Leu242fs	frameshift splice_region	Exon 4 of 4	ENSP00000492390.1	A0A1W2PR18

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Intellectual disability, X-linked 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs1556863457;

hg19: chrX-53280154;