rs1556863457

Positions:

• chrX-53250972-GTGCTGGGCAGTCGCTCAGGGGATTGTTGGGGAACTGTGTCATCCAGGTAGAGGGGAAGATCACTGAAGGATGTGGCTGAGCTGTCCTCTTGCTGTTCCTTTGACTCCCGCTTCTCCAGCTGGGCTGACCCTGGCTCCTCAGACATGGGCCCTGACGGGTGGCAGTTCA-G

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_001111125.3(IQSEC2):​c.1436_1603del​(p.Leu479_Thr535delinsPro) variant causes a inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 23)
• Consequence: IQSEC2 NM_001111125.3 inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.58

Genes affected

IQSEC2 (HGNC:29059): (IQ motif and Sec7 domain ArfGEF 2) This gene encodes a guanine nucleotide exchange factor for the ARF family of small GTP-binding proteins. The encoded protein is a component of the postsynaptic density at excitatory synapses, and may play a critical role in cytoskeletal and synaptic organization through the activation of selected ARF substrates including ARF1 and ARF6. Mutations in this gene have been implicated in nonsyndromic X-linked cognitive disability. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001111125.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
IQSEC2	NM_001111125.3	c.1436_1603del	p.Leu479_Thr535delinsPro	inframe_deletion	5/15	ENST00000642864.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
IQSEC2	ENST00000642864.1	c.1436_1603del	p.Leu479_Thr535delinsPro	inframe_deletion	5/15		NM_001111125.3	P1

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Intellectual disability, X-linked 1 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Jan 10, 2018

This variant, c.1436_1603del, results in the deletion of 56 amino acids and inserts 1 amino acid in to the IQSEC2 protein (p.Leu479_Thr535delinsPro), but otherwise preserves the integrity of the reading frame. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the disrupted amino acids is currently unknown. This variant has not been reported in the literature in individuals with IQSEC2-related disease. This variant is not present in population databases (ExAC no frequency). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1556863457; hg19: chrX-53280154;