rs1556886127

Positions:

• chrX-53383144-ATGGCCTTCATGTTGGGGGCGGCAATAC-ACTGCA

Variant summary

Our verdict is Pathogenic. Variant got 13 ACMG points: 13P and 0B. PVS1 PM2 PP2 PP5_Moderate

The NM_006306.4(SMC1A):​c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG​(p.Arg1019fs) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: SMC1A NM_006306.4 frameshift, missense
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1 O:1
• Conservation: PhyloP100: 9.23

Genes affected

SMC1A (HGNC:11111): (structural maintenance of chromosomes 1A) Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

ACMG classification

Verdict is Pathogenic. Variant got 13 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP2: Missense variant in gene, where missense usually causes diseases (based on misZ statistic), SMC1A. . Gene score misZ 6.4479 (greater than the threshold 3.09). GenCC has associacion of gene with Cornelia de Lange syndrome, X-linked complex neurodevelopmental disorder, atypical Rett syndrome, Cornelia de Lange syndrome 2, developmental and epileptic encephalopathy, 85, with or without midline brain defects.
• PP5: Variant X-53383145-TGGCCTTCATGTTGGGGGCGGCAATAC-CTGCA is Pathogenic according to our data. Variant chrX-53383145-TGGCCTTCATGTTGGGGGCGGCAATAC-CTGCA is described in ClinVar as [Likely_pathogenic]. Clinvar id is 532571.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SMC1A	NM_006306.4	c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg1019fs	frameshift_variant, missense_variant	20/25	ENST00000322213.9	NP_006297.2
SMC1A	NM_001281463.1	c.2990_3016delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg997fs	frameshift_variant, missense_variant	21/26		NP_001268392.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SMC1A	ENST00000322213.9	c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg1019fs	frameshift_variant, missense_variant	20/25	1	NM_006306.4	ENSP00000323421.3

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1 Other:1

Revision: criteria provided, single submitter

Submissions by phenotype

Congenital muscular hypertrophy-cerebral syndrome Pathogenic:1 Other:1

not provided, no classification provided	phenotyping only	GenomeConnect - Invitae Patient Insights Network	-	Variant interpreted as Likely pathogenic and reported on 12-27-2017 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information. -
Likely pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Dec 13, 2017	In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. A different variant present in the disrupted region (p.Tyr1085Cys) has been determined to be likely pathogenic (PMID: 17221863, Invitae). This suggests that the tyrosine residue is critical for SMC1A protein function and that other variants disrupting this position may also be pathogenic. This variant has not been reported in the literature in individuals with SMC1A-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the SMC1A gene (p.Arg1019Leufs*186). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt 185 amino acids and delete the last 30 amino acids of the SMC1A protein. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1556886127; hg19: chrX-53410066;