rs1556886127

Variant names:

• chrX-53383145-TGGCCTTCATGTTGGGGGCGGCAATAC-CTGCA
• rs1556886127
• NM_006306.4:c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_006306.4(SMC1A):​c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG​(p.Arg1019LeufsTer186) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: SMC1A NM_006306.4 frameshift, missense
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1 O:1
• Conservation: PhyloP100: 9.23
• Publications: 0 publications found

Genes affected

SMC1A (HGNC:11111): (structural maintenance of chromosomes 1A) Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

SMC1A Gene-Disease associations (from GenCC):

• Cornelia de Lange syndrome 2

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• developmental and epileptic encephalopathy, 85, with or without midline brain defects

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• X-linked complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Cornelia de Lange syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant X-53383145-TGGCCTTCATGTTGGGGGCGGCAATAC-CTGCA is Pathogenic according to our data. Variant chrX-53383145-TGGCCTTCATGTTGGGGGCGGCAATAC-CTGCA is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 532571.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SMC1A	NM_006306.4	c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg1019LeufsTer186	frameshift_variant, missense_variant	Exon 20 of 25	ENST00000322213.9	NP_006297.2
SMC1A	NM_001281463.1	c.2990_3016delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg997LeufsTer186	frameshift_variant, missense_variant	Exon 21 of 26		NP_001268392.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SMC1A	ENST00000322213.9	c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg1019LeufsTer186	frameshift_variant, missense_variant	Exon 20 of 25	1	NM_006306.4	ENSP00000323421.3

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1 Other:1

Revision: criteria provided, single submitter

Submissions by phenotype

Congenital muscular hypertrophy-cerebral syndrome Pathogenic:1 Other:1

-

GenomeConnect - Invitae Patient Insights Network

Significance: not provided

Review Status: no classification provided

Collection Method: phenotyping only

Variant interpreted as Likely pathogenic and reported on 12-27-2017 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information. -

Dec 13, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. A different variant present in the disrupted region (p.Tyr1085Cys) has been determined to be likely pathogenic (PMID: 17221863, Invitae). This suggests that the tyrosine residue is critical for SMC1A protein function and that other variants disrupting this position may also be pathogenic. This variant has not been reported in the literature in individuals with SMC1A-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the SMC1A gene (p.Arg1019Leufs*186). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt 185 amino acids and delete the last 30 amino acids of the SMC1A protein. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1556886127; hg19: chrX-53410066;