rs1556886127

Variant names:

• chrX-53383145-TGGCCTTCATGTTGGGGGCGGCAATAC-CTGCA
• rs1556886127
• NM_006306.4:c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_006306.4(SMC1A):​c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG​(p.Arg1019LeufsTer186) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: SMC1A NM_006306.4 frameshift, missense
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1 O:1
• Conservation: PhyloP100: 9.23
• Publications: 0 publications found

Genes affected

SMC1A (HGNC:11111): (structural maintenance of chromosomes 1A) Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

SMC1A Gene-Disease associations (from GenCC):

• Cornelia de Lange syndrome 2

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, G2P
• developmental and epileptic encephalopathy, 85, with or without midline brain defects

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, G2P, Labcorp Genetics (formerly Invitae)
• X-linked complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Cornelia de Lange syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant X-53383145-TGGCCTTCATGTTGGGGGCGGCAATAC-CTGCA is Pathogenic according to our data. Variant chrX-53383145-TGGCCTTCATGTTGGGGGCGGCAATAC-CTGCA is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 532571.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006306.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMC1A	NM_006306.4	MANE Select	c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg1019LeufsTer186	frameshift missense	Exon 20 of 25	NP_006297.2
	SMC1A	NM_001281463.1		c.2990_3016delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg997LeufsTer186	frameshift missense	Exon 21 of 26	NP_001268392.1	G8JLG1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMC1A	ENST00000322213.9	TSL:1 MANE Select	c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg1019LeufsTer186	frameshift missense	Exon 20 of 25	ENSP00000323421.3	Q14683
	SMC1A	ENST00000375340.10	TSL:1	c.2990_3016delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg997LeufsTer186	frameshift missense	Exon 21 of 26	ENSP00000364489.7	G8JLG1
	SMC1A	ENST00000675504.1		c.2990_3016delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG	p.Arg997LeufsTer186	frameshift missense	Exon 20 of 25	ENSP00000502524.1	G8JLG1

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Congenital muscular hypertrophy-cerebral syndrome (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs1556886127;

hg19: chrX-53410066;