rs1557135441

Variant names:

• chrX-154030636-CCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGA-C
• rs1557135441
• NM_001110792.2:c.1159_1227delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001110792.2(MECP2):​c.1159_1227delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG​(p.Ser387_Glu409del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000000915 in 1,093,222 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. S387S) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 17)
  • Exomes 𝑓: 9.1e-7 (0 hom. 0 hem.)
• Consequence: MECP2 NM_001110792.2 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:2
• Conservation: PhyloP100: 5.66
• Publications: 0 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001110792.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1159_1227delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG	p.Ser387_Glu409del	conservative_inframe_deletion	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1123_1191delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG	p.Ser375_Glu397del	conservative_inframe_deletion	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1159_1227delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG	p.Ser387_Glu409del	conservative_inframe_deletion	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1123_1191delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG	p.Ser375_Glu397del	conservative_inframe_deletion	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 17

GnomAD4 exome AF: 9.15e-7 AC: 1 AN: 1093222 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 360664

African (AFR) AF: 0.00 AC: 0 AN: 26389

American (AMR) AF: 0.00 AC: 0 AN: 35200

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19376

East Asian (EAS) AF: 0.00 AC: 0 AN: 30195

South Asian (SAS) AF: 0.00 AC: 0 AN: 54110

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 36548

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3861

European-Non Finnish (NFE) AF: 0.00000119 AC: 1 AN: 841552

Other (OTH) AF: 0.00 AC: 0 AN: 45991

GnomAD4 genome Cov.: 17

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, single submitter

Submissions by phenotype

Rett syndrome Uncertain:2

Jan 12, 2024

Centre for Population Genomics, CPG

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as a variant of uncertain significance. At least the following criteria are met: The variant is observed in at least 1 individual with no features of Rett Syndrome (BS2_Supporting) -

Apr 10, 2002

RettBASE

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7
Mutation Taster		=1/199	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1557135441; hg19: chrX-153296087;