rs1557135441

Positions:

• chrX-154030636-CCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGA-C

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_001110792.2(MECP2):​c.1159_1227delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG​(p.Ser387_Glu409del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000000915 in 1,093,222 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 17)
  • Exomes 𝑓: 9.1e-7 (0 hom. 0 hem.)
• Consequence: MECP2 NM_001110792.2 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:2
• Conservation: PhyloP100: 5.66

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001110792.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1159_1227delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG	p.Ser387_Glu409del	conservative_inframe_deletion	3/3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1123_1191delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG	p.Ser375_Glu397del	conservative_inframe_deletion	4/4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1159_1227delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG	p.Ser387_Glu409del	conservative_inframe_deletion	3/3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1123_1191delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG	p.Ser375_Glu397del	conservative_inframe_deletion	4/4	1	NM_004992.4	ENSP00000301948.6
MECP2	ENST00000407218	c.*495_*563delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG		3_prime_UTR_variant	4/4	5		ENSP00000384865.2
MECP2	ENST00000628176	c.*495_*563delTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG		3_prime_UTR_variant	5/5	3		ENSP00000486978.1

Frequencies

GnomAD3 genomes Cov.: 17

GnomAD4 exome AF: 9.15e-7 AC: 1 AN: 1093222 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 360664

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000119

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 17

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, single submitter

Submissions by phenotype

Rett syndrome Uncertain:2

Uncertain significance, criteria provided, single submitter	curation	Centre for Population Genomics, CPG	Jan 12, 2024	This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as a variant of uncertain significance. At least the following criteria are met: The variant is observed in at least 1 individual with no features of Rett Syndrome (BS2_Supporting) -
Uncertain significance, no assertion criteria provided	curation	RettBASE	Apr 10, 2002	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1557135441; hg19: chrX-153296087;