rs1557135539

Positions:

• chrX-154030643-GCTCTCGGGCTCAGGTGGAGGT-G

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_001110792.2(MECP2):​c.1200_1220del​(p.Pro401_Ser407del) variant causes a inframe deletion change. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 16)
• Consequence: MECP2 NM_001110792.2 inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.37

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001110792.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1200_1220del	p.Pro401_Ser407del	inframe_deletion	3/3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1164_1184del	p.Pro389_Ser395del	inframe_deletion	4/4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000303391.11	c.1164_1184del	p.Pro389_Ser395del	inframe_deletion	4/4	1	NM_004992.4	ENSP00000301948	P1
MECP2	ENST00000453960.7	c.1200_1220del	p.Pro401_Ser407del	inframe_deletion	3/3	1	NM_001110792.2	ENSP00000395535
MECP2	ENST00000407218.5	c.*536_*556del		3_prime_UTR_variant	4/4	5		ENSP00000384865
MECP2	ENST00000628176.2	c.*536_*556del		3_prime_UTR_variant	5/5	3		ENSP00000486978

Frequencies

GnomAD3 genomes Cov.: 16

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 16

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Severe neonatal-onset encephalopathy with microcephaly Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Oct 30, 2017

Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant has not been reported in the literature in individuals with MECP2-related disease. This variant is not present in population databases (ExAC no frequency). This variant, c.1164_1184delACCTCCACCTGAGCCCGAGAG, results in the deletion of 7 amino acids of the MECP2 protein (p.Pro389_Ser395del), but otherwise preserves the integrity of the reading frame. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1557135539; hg19: chrX-153296094;