rs1673287743

Variant names:

• chr1-155900399-A-AATCTTTCTTCTTCCGGAATGGTGATTTTAGCCTCTTCCATACACTGTTTTTGGGCTTAGATTTTTTCTCCATGGCCAGTACTGCCT
• rs1673287743
• NM_006912.6:c.563_648dupAGGCAGTACTGGCCATGGAGAAAAAATCTAAGCCCAAAAACAGTGTATGGAAGAGGCTAAAATCACCATTCCGGAAGAAGAAAGAT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_006912.6(RIT1):​c.563_648dupAGGCAGTACTGGCCATGGAGAAAAAATCTAAGCCCAAAAACAGTGTATGGAAGAGGCTAAAATCACCATTCCGGAAGAAGAAAGAT​(p.Ser217ArgfsTer20) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: RIT1 NM_006912.6 frameshift, stop_gained
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.272

Genes affected

RIT1 (HGNC:10023): (Ras like without CAAX 1) This gene encodes a member of a subfamily of Ras-related GTPases. The encoded protein is involved in regulating p38 MAPK-dependent signaling cascades related to cellular stress. This protein also cooperates with nerve growth factor to promote neuronal development and regeneration. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0182 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RIT1	NM_006912.6	c.563_648dupAGGCAGTACTGGCCATGGAGAAAAAATCTAAGCCCAAAAACAGTGTATGGAAGAGGCTAAAATCACCATTCCGGAAGAAGAAAGAT	p.Ser217ArgfsTer20	frameshift_variant, stop_gained	Exon 6 of 6	ENST00000368323.8	NP_008843.1
RIT1	NM_001256821.2	c.614_699dupAGGCAGTACTGGCCATGGAGAAAAAATCTAAGCCCAAAAACAGTGTATGGAAGAGGCTAAAATCACCATTCCGGAAGAAGAAAGAT	p.Ser234ArgfsTer20	frameshift_variant, stop_gained	Exon 6 of 6		NP_001243750.1
RIT1	NM_001256820.2	c.455_540dupAGGCAGTACTGGCCATGGAGAAAAAATCTAAGCCCAAAAACAGTGTATGGAAGAGGCTAAAATCACCATTCCGGAAGAAGAAAGAT	p.Ser181ArgfsTer20	frameshift_variant, stop_gained	Exon 5 of 5		NP_001243749.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RIT1	ENST00000368323.8	c.563_648dupAGGCAGTACTGGCCATGGAGAAAAAATCTAAGCCCAAAAACAGTGTATGGAAGAGGCTAAAATCACCATTCCGGAAGAAGAAAGAT	p.Ser217ArgfsTer20	frameshift_variant, stop_gained	Exon 6 of 6	1	NM_006912.6	ENSP00000357306.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Apr 20, 2020

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: RIT1 c.563_648dup86 (p.Ser217ArgfsX20) causes a frameshift which results in an extension of the protein. The variant was absent in 251364 control chromosomes. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.563_648dup86 in individuals affected with Noonan Syndrome And Related Conditions and no experimental evidence demonstrating its impact on protein function have been reported. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as uncertain significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1673287743; hg19: chr1-155870190;