rs199475697

Variant names:

• chr12-102855228-TCATAGCAAGCATGGGTTTTATA-T
• rs199475697
• NM_000277.3:c.592_613delTATAAAACCCATGCTTGCTATG

Variant summary

Our verdict is Pathogenic. Variant got 16 ACMG points: 16P and 0B. PVS1 PM2 PP4_Moderate PM3_Strong

This summary comes from the ClinGen Evidence Repository: The c.592_613del (p.Tyr198fs) variant in PAH is a frameshift variant predicted to cause termination at amino acid 334 in exon 10, resulting in nonsense mediated decay in a gene in which loss-of-function is an established disease mechanism. It has been detected in multiple patients with PAH deficiency with pathogenic variants: c.782G>A (p.Arg261Gln) (PMID:21890392); c.1222C>T (p.Arg408Trp) (PMID:26481238); c.969+1G>A (IVS9 + 1G>A) (PMID:18321666); c.311C>A (p.A104D), c.755G>A (p.R252Q) (PMID:23942198). This variant is absent in population databases. In summary, this variant meets criteria to be classified as Pathogenic for PAH deficiency based on the ACMG/AMP criteria applied, as specified by the ClinGen PAH VCEP: PM2, PM3_strong, PP4_moderate, PVS1 LINK:https://erepo.genome.network/evrepo/ui/classification/CA229638/MONDO:0009861/006

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000027 (0 hom.)
• Consequence: PAH NM_000277.3 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:10 O:1
• Conservation: PhyloP100: 10.0

Genes affected

PAH (HGNC:8582): (phenylalanine hydroxylase) This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase protein family. The encoded phenylalanine hydroxylase enzyme hydroxylates phenylalanine to tyrosine and is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Aug 2017]

ACMG classification

Verdict is Pathogenic. Variant got 16 ACMG points.

• PVS1: For more information check the summary or visit ClinGen Evidence Repository.
• PM2: For more information check the summary or visit ClinGen Evidence Repository.
• PM3: For more information check the summary or visit ClinGen Evidence Repository.
• PP4: For more information check the summary or visit ClinGen Evidence Repository.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PAH	NM_000277.3	c.592_613delTATAAAACCCATGCTTGCTATG	p.Tyr198SerfsTer136	frameshift_variant	Exon 6 of 13	ENST00000553106.6	NP_000268.1
PAH	NM_001354304.2	c.592_613delTATAAAACCCATGCTTGCTATG	p.Tyr198SerfsTer136	frameshift_variant	Exon 7 of 14		NP_001341233.1
PAH	XM_017019370.2	c.592_613delTATAAAACCCATGCTTGCTATG	p.Tyr198SerfsTer66	frameshift_variant	Exon 6 of 7		XP_016874859.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PAH	ENST00000553106.6	c.592_613delTATAAAACCCATGCTTGCTATG	p.Tyr198SerfsTer136	frameshift_variant	Exon 6 of 13	1	NM_000277.3	ENSP00000448059.1
PAH	ENST00000549111.5	n.688_709delTATAAAACCCATGCTTGCTATG		non_coding_transcript_exon_variant	Exon 6 of 6	1
PAH	ENST00000307000.7	c.577_598delTATAAAACCCATGCTTGCTATG	p.Tyr193SerfsTer136	frameshift_variant	Exon 7 of 14	5		ENSP00000303500.2
PAH	ENST00000551988.5	n.*29_*50delTATAAAACCCATGCTTGCTATG		downstream_gene_variant		3

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152224 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000199 AC: 5 AN: 251328 Hom.: 0 AF XY: 0.00000736 AC XY: 1 AN XY: 135822

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000145

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000274 AC: 4 AN: 1461738 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727186

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000894

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152224 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74372

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000147

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:10 Other:1

Revision: reviewed by expert panel

Submissions by phenotype

Phenylketonuria Pathogenic:8

Aug 20, 2020

Natera, Inc.

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Mar 30, 2021

Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PAH NM_000277.2 exon 6 p.Tyr198Serfs*136 (c.592_613del): This variant has been reported in the literature in the homozygous state in two individuals with phenylketonuria (Daniele 2009 PMID:19292873, Ajami 2013 PMID:24301756) and has been reported in the PAH Consortium Database (www.biopku.org). This variant is present in 0.01% (5/35428) of Latino alleles in the Genome Aggregation Database (https://gnomad.broadinstitute.org/variant/12-103249006-TCATAGCAAGCATGGGTTTTATA-T). Please note, disease causing variants may be present in control databases at low frequencies, reflective of the general population, carrier status, and/or variable expressivity. This variant is present in ClinVar (Variation ID:102746). Evolutionary conservation and computational predictive tools for this variant are limited or unavailable. This variant represents a deletion of 22 nucleotides and creates a premature stop codon 136 amino acids downstream from this location which results in an absent or abnormal protein. Loss of function variants have been reported in association with disease for this gene (Eisensmith 1992 PMID:1301187, Guldberg 1998 PMID:9634518). In summary, this variant is classified as pathogenic based on the data above. -

Mar 16, 2023

ClinGen PAH Variant Curation Expert Panel

Significance: Pathogenic

Review Status: reviewed by expert panel

Collection Method: curation

The c.592_613del (p.Tyr198fs) variant in PAH is a frameshift variant predicted to cause termination at amino acid 334 in exon 10, resulting in nonsense mediated decay in a gene in which loss-of-function is an established disease mechanism. It has been detected in multiple patients with PAH deficiency with pathogenic variants: c.782G>A (p.Arg261Gln) (PMID: 21890392); c.1222C>T (p.Arg408Trp) (PMID:26481238); c.969+1G>A (IVS9 + 1G>A) (PMID:18321666); c.311C>A (p.A104D), c.755G>A (p.R252Q) (PMID:23942198). This variant is absent in population databases. In summary, this variant meets criteria to be classified as Pathogenic for PAH deficiency based on the ACMG/AMP criteria applied, as specified by the ClinGen PAH VCEP: PM2, PM3_strong, PP4_moderate, PVS1 -

Feb 25, 2014

Counsyl

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Mar 02, 2024

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Aug 03, 2023

3billion

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The variant is observed at an extremely low frequency in the gnomAD v2.1.1 dataset (total allele frequency: 0.002%). Predicted Consequence/Location: Frameshift: predicted to result in a loss or disruption of normal protein function through nonsense-mediated decay (NMD) or protein truncation. Multiple pathogenic variants are reported downstream of the variant. The variant has been reported to be in trans with a pathogenic variant as either compound heterozygous or homozygous in at least one similarly affected unrelated individual (PMID: 26481238). The variant has been reported at least twice as pathogenic with clinical assertions and evidence for the classification (ClinVar ID: VCV000102746 /PMID: 1301943 /3billion dataset). Therefore, this variant is classified as Pathogenic according to the recommendation of ACMG/AMP guideline. -

Jul 05, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Tyr198Serfs*136) in the PAH gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PAH are known to be pathogenic (PMID: 1301187, 9634518). This variant is present in population databases (rs199475697, gnomAD 0.01%). This premature translational stop signal has been observed in individual(s) with phenylketonuria or hyperphenylalaninemia (PMID: 9359039, 21890392, 24301756). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 102746). For these reasons, this variant has been classified as Pathogenic. -

Jan 21, 2016

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: This c.592_613del22 variant causes a frameshift, which alters the proteins amino acid sequence beginning at position 198 and leads to a premature termination codon 136 amino acids downstream. It is predicted to cause a truncated or absent PAH protein. Loss-of-function due to mutations in this gene is an established disease mechanism in Phenylketoneuria. This variant was not found in approximately 121322 chromosomes from the broad and large populations of ExAC. This variant has been recurrently reported as a causative mutation in patients with Phenylketoneuria. The region this variant is located is a mutational hot-spot where other similar pathogenic frameshift variants (such as c.586del22, c.589del22, c.590del23 and c.593del22) (source: HGMD) have been reported. Reputable databases have also classified this variant as pathogenic. Taken together, this variant has been classified as a Pathogenic. -

not provided Pathogenic:1 Other:1

-

DeBelle Laboratory for Biochemical Genetics, MUHC/MCH RESEARCH INSTITUTE

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Aug 26, 2024

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 26701937, 22572109, 10767174, 17096675, 24301756, 28676969, 21147011, 36646061, 35405047, 8069318, 19292873) -

Inborn genetic diseases Pathogenic:1

Dec 21, 2021

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.592_613del22 (p.Y198Sfs*136) alteration, located in exon 6 (coding exon 6) of the PAH gene, consists of a deletion of 22 nucleotides from position 592 to 613, causing a translational frameshift with a predicted alternate stop codon after 136 amino acids. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). This mutation has been reported in the homozygous state and in trans with a second alteration in patients with phenylalanine hydroxylase deficiency (Daniele, 2009; Kostandyan, 2011; Ajami, 2013; Carducci, 2020). Based on the available evidence, this alteration is classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs199475697; hg19: chr12-103249006;