rs267608329

Variant names:

• chrX-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGG-T
• rs267608329
• NM_001110792.2:c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001110792.2(MECP2):​c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC​(p.Leu398AlafsTer8) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000371 in 1,077,997 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 1 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P397P) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., 0 hem., cov: 17)
  • Exomes 𝑓: 0.0000030 (0 hom. 1 hem.)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:7
• Conservation: PhyloP100: 3.50
• Publications: 3 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 168 pathogenic variants in the truncated region.
• PP5: Variant X-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGG-T is Pathogenic according to our data. Variant chrX-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGG-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 143360.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu398AlafsTer8	frameshift_variant	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1155_1200delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu386AlafsTer8	frameshift_variant	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu398AlafsTer8	frameshift_variant	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1155_1200delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu386AlafsTer8	frameshift_variant	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes AF: 0.0000126 AC: 1 AN: 79310 Hom.: 0 Cov.: 17

Gnomad AFR AF: 0.0000499

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000567 AC: 1 AN: 176334 AF XY: 0.0000155

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000367

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000300 AC: 3 AN: 998687 Hom.: 0 AF XY: 0.00000310 AC XY: 1 AN XY: 322629

African (AFR) AF: 0.00 AC: 0 AN: 23812

American (AMR) AF: 0.0000302 AC: 1 AN: 33118

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16012

East Asian (EAS) AF: 0.00 AC: 0 AN: 22417

South Asian (SAS) AF: 0.00 AC: 0 AN: 50842

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 27210

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3457

European-Non Finnish (NFE) AF: 0.00000256 AC: 2 AN: 782048

Other (OTH) AF: 0.00 AC: 0 AN: 39771

GnomAD4 genome AF: 0.0000126 AC: 1 AN: 79310 Hom.: 0 Cov.: 17 AF XY: 0.00 AC XY: 0 AN XY: 18894

African (AFR) AF: 0.0000499 AC: 1 AN: 20025

American (AMR) AF: 0.00 AC: 0 AN: 6750

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2116

East Asian (EAS) AF: 0.00 AC: 0 AN: 2466

South Asian (SAS) AF: 0.00 AC: 0 AN: 1475

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 3186

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 188

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 41592

Other (OTH) AF: 0.00 AC: 0 AN: 982

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:7

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Rett syndrome Pathogenic:2

Jan 10, 2024

Centre for Population Genomics, CPG

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). ClinVar Variation ID: 143360, PMID: 23696494, 12180070 , 16473305 This variant has been identified as a de novo occurrence in an individual with Rett syndrome without confirmation of paternity and maternity (PM6). PMID 23696494 This variant is absent from gnomAD (PM2_Supporting). -

Jan 21, 2008

RettBASE

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

not provided Pathogenic:2

Nov 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

MECP2: PVS1, PM2:Supporting -

Oct 04, 2024

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Identified in two unrelated females with Rett syndrome; however, in both published cases the c.1155_1200del46 variant was likely part of a complex allele, as one of the patients also harbored an in-frame insertion/deletion while the other had a second frameshift variant in MECP2 (PMID: 11738860, 12655490); Also reported as an isolated pathogenic variant in two unrelated females in RettBASE; however, no additional information is available regarding the phenotype or family history (PMID: 12673788); Frameshift variant predicted to result in protein truncation in a gene for which loss of function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 12655490, 16473305, 19914908, 12872250, 11738860, 12673788, Shields2024[Abstract]) -

Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1

Sep 23, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Leu386Alafs*8) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. This variant is present in population databases (rs267608329, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with clinical features of Rett syndrome (PMID: 16473305, 19914908). This variant is also known as c.1152_1197del. ClinVar contains an entry for this variant (Variation ID: 143360). This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Pro389*) have been determined to be pathogenic (PMID: 17089071, 17387578, 19914908, 20151026, 21982064). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Syndromic X-linked intellectual disability Lubs type Pathogenic:1

Aug 23, 2023

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Rett syndrome;C0796222:X-linked intellectual disability-psychosis-macroorchidism syndrome;C1845336:Autism, susceptibility to, X-linked 3;C1846058:Syndromic X-linked intellectual disability Lubs type;C1968556:Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1

-

Juno Genomics, Hangzhou Juno Genomics, Inc

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PM2_Supporting+PVS1+PS4_Moderate -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs267608329; hg19: chrX-153296078;