rs267608329

Variant names:

• chrX-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGG-T
• rs267608329
• NM_001110792.2:c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001110792.2(MECP2):​c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC​(p.Leu398AlafsTer8) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000371 in 1,077,997 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 1 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P397P) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., 0 hem., cov: 17)
  • Exomes 𝑓: 0.0000030 (0 hom. 1 hem.)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:8
• Conservation: PhyloP100: 3.50
• Publications: 3 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 168 pathogenic variants in the truncated region.
• PP5: Variant X-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGG-T is Pathogenic according to our data. Variant chrX-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGG-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 143360.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	NM_001110792.2	MANE Select	c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu398AlafsTer8	frameshift	Exon 3 of 3	NP_001104262.1
	MECP2	NM_004992.4	MANE Plus Clinical	c.1155_1200delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu386AlafsTer8	frameshift	Exon 4 of 4	NP_004983.1
	MECP2	NM_001316337.2		c.876_921delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu293AlafsTer8	frameshift	Exon 5 of 5	NP_001303266.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	ENST00000453960.7	TSL:1 MANE Select	c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu398AlafsTer8	frameshift	Exon 3 of 3	ENSP00000395535.2
	MECP2	ENST00000303391.11	TSL:1 MANE Plus Clinical	c.1155_1200delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu386AlafsTer8	frameshift	Exon 4 of 4	ENSP00000301948.6
	MECP2	ENST00000630151.3	TSL:5	c.1155_1200delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu386AlafsTer8	frameshift	Exon 4 of 4	ENSP00000486089.2

Frequencies

GnomAD3 genomes AF: 0.0000126 AC: 1 AN: 79310 Hom.: 0 Cov.: 17

Gnomad AFR AF: 0.0000499

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000567 AC: 1 AN: 176334 AF XY: 0.0000155

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000367

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000300 AC: 3 AN: 998687 Hom.: 0 AF XY: 0.00000310 AC XY: 1 AN XY: 322629

African (AFR) AF: 0.00 AC: 0 AN: 23812

American (AMR) AF: 0.0000302 AC: 1 AN: 33118

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16012

East Asian (EAS) AF: 0.00 AC: 0 AN: 22417

South Asian (SAS) AF: 0.00 AC: 0 AN: 50842

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 27210

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3457

European-Non Finnish (NFE) AF: 0.00000256 AC: 2 AN: 782048

Other (OTH) AF: 0.00 AC: 0 AN: 39771

GnomAD4 genome AF: 0.0000126 AC: 1 AN: 79310 Hom.: 0 Cov.: 17 AF XY: 0.00 AC XY: 0 AN XY: 18894

African (AFR) AF: 0.0000499 AC: 1 AN: 20025

American (AMR) AF: 0.00 AC: 0 AN: 6750

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2116

East Asian (EAS) AF: 0.00 AC: 0 AN: 2466

South Asian (SAS) AF: 0.00 AC: 0 AN: 1475

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 3186

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 188

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 41592

Other (OTH) AF: 0.00 AC: 0 AN: 982

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	not provided (3)
2	-	-	Rett syndrome (2)
1	-	-	Rett syndrome;C0796222:X-linked intellectual disability-psychosis-macroorchidism syndrome;C1845336:Autism, susceptibility to, X-linked 3;C1846058:Syndromic X-linked intellectual disability Lubs type;C1968556:Severe neonatal-onset encephalopathy with microcephaly (1)
1	-	-	Severe neonatal-onset encephalopathy with microcephaly (1)
1	-	-	Syndromic X-linked intellectual disability Lubs type (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs267608329; hg19: chrX-153296078;