rs267608372

Variant names:

• chrX-154030632-GGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGT-G
• rs267608372
• NM_001110792.2:c.1188_1231delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001110792.2(MECP2):​c.1188_1231delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC​(p.Pro397HisfsTer5) variant causes a frameshift change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P396P) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 17)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 5.66
• Publications: 3 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 173 pathogenic variants in the truncated region.
• PP5: Variant X-154030632-GGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGT-G is Pathogenic according to our data. Variant chrX-154030632-GGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 143354.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1188_1231delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC	p.Pro397HisfsTer5	frameshift_variant	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1152_1195delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC	p.Pro385HisfsTer5	frameshift_variant	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1188_1231delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC	p.Pro397HisfsTer5	frameshift_variant	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1152_1195delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC	p.Pro385HisfsTer5	frameshift_variant	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 17

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 17

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Rett syndrome Pathogenic:4

Feb 15, 2011

RettBASE

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Jan 09, 2024

Centre for Population Genomics, CPG

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). (ClinVar Variation ID:143354, RettBASE, PMID: 10767337, 19914908, 17089071, 29428920, 16473305, 18842453, 16672765, 31645986, 14734626, 15578576, 11738879, 12111643) . This variant has been identified as a de novo occurrence in at least one individual with Rett syndrome without confirmation of paternity and maternity (PM6).(PMID: 17089071, 10767337). This variant is absent from gnomAD (PM2_Supporting). -

Apr 12, 2000

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Feb 08, 2013

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1

Mar 23, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Pro385Hisfs*5) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 102 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Rett syndrome (PMID: 11269512, 17089071, 19914908). This variant is also known as 1152del44. ClinVar contains an entry for this variant (Variation ID: 143354). This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Gln406*) have been determined to be pathogenic (PMID: 10986043, 14560307, 22476991). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs267608372; hg19: chrX-153296083;