rs267608574

Variant names:

• chrX-154030639-CGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTG-C
• rs267608574
• NM_001110792.2:c.1187_1224delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Strong PP5_Very_Strong

The NM_001110792.2(MECP2):​c.1187_1224delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC​(p.Pro396ArgfsTer8) variant causes a frameshift change. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 16)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 5.66

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.207 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PP5: Variant X-154030639-CGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTG-C is Pathogenic according to our data. Variant chrX-154030639-CGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTG-C is described in ClinVar as [Pathogenic]. Clinvar id is 143351.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-154030639-CGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTG-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1187_1224delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC	p.Pro396ArgfsTer8	frameshift_variant	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1151_1188delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC	p.Pro384ArgfsTer8	frameshift_variant	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1187_1224delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC	p.Pro396ArgfsTer8	frameshift_variant	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1151_1188delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC	p.Pro384ArgfsTer8	frameshift_variant	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 16

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 16

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Rett syndrome Pathogenic:2

Nov 05, 2009

RettBASE

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Mar 14, 2024

Centre for Population Genomics, CPG

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant has been identified as a de novo occurrence in an individual with Rett syndrome without confirmation of paternity and maternity (PM6). PMID 19371229 This variant is absent from gnomAD (PM2_Supporting). -

Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1

Mar 31, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Pro469Alafs*18) have been determined to be pathogenic (PMID: 32860008). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. ClinVar contains an entry for this variant (Variation ID: 143351). This premature translational stop signal has been observed in individual(s) with Rett syndrome (PMID: 19371229). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Pro384Argfs*8) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 103 amino acid(s) of the MECP2 protein. -

not provided Pathogenic:1

Apr 04, 2024

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: Khajuria2020[CaseReport], 19371229) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs267608574; hg19: chrX-153296090;