rs267608605

Variant names:

• chrX-154030619-AGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT-A
• rs267608605
• NM_001110792.2:c.1200_1244delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 4P and 2B. PM1 PM4 BP6_Moderate

The NM_001110792.2(MECP2):​c.1200_1244delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC​(p.Pro401_Pro415del) variant causes a disruptive inframe deletion change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. P400P) has been classified as Benign.

• Frequency:
  • Genomes: not found (cov: 18)
  • Exomes 𝑓: 0.0000011 (0 hom. 0 hem.)
  • Failed GnomAD Quality Control
• Consequence: MECP2 NM_001110792.2 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter U:1 B:1
• Conservation: PhyloP100: 4.53
• Publications: 0 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, Orphanet, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM1: In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 19 benign, 18 uncertain in NM_001110792.2
• PM4: Nonframeshift variant in NON repetitive region in NM_001110792.2.
• BP6: Variant X-154030619-AGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT-A is Benign according to our data. Variant chrX-154030619-AGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT-A is described in ClinVar as Likely_benign. ClinVar VariationId is 143407.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	NM_001110792.2	MANE Select	c.1200_1244delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Pro401_Pro415del	disruptive_inframe_deletion	Exon 3 of 3	NP_001104262.1	A0A140VKC4
	MECP2	NM_004992.4	MANE Plus Clinical	c.1164_1208delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Pro389_Pro403del	disruptive_inframe_deletion	Exon 4 of 4	NP_004983.1	D3YJ43
	MECP2	NM_001316337.2		c.885_929delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Pro296_Pro310del	disruptive_inframe_deletion	Exon 5 of 5	NP_001303266.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	ENST00000453960.7	TSL:1 MANE Select	c.1200_1244delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Pro401_Pro415del	disruptive_inframe_deletion	Exon 3 of 3	ENSP00000395535.2	P51608-2
	MECP2	ENST00000303391.11	TSL:1 MANE Plus Clinical	c.1164_1208delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Pro389_Pro403del	disruptive_inframe_deletion	Exon 4 of 4	ENSP00000301948.6	P51608-1
	MECP2	ENST00000630151.3	TSL:5	c.1164_1208delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Pro389_Pro403del	disruptive_inframe_deletion	Exon 4 of 4	ENSP00000486089.2	P51608-1

Frequencies

GnomAD3 genomes Cov.: 18

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000111 AC: 1 AN: 900611 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 290651

African (AFR) AF: 0.00 AC: 0 AN: 21090

American (AMR) AF: 0.00 AC: 0 AN: 30525

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 12696

East Asian (EAS) AF: 0.00 AC: 0 AN: 14981

South Asian (SAS) AF: 0.00 AC: 0 AN: 47183

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 20722

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2985

European-Non Finnish (NFE) AF: 0.00000139 AC: 1 AN: 716876

Other (OTH) AF: 0.00 AC: 0 AN: 33553

GnomAD4 genome Cov.: 18

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	1	Rett syndrome (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5
Mutation Taster		=21/179	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs267608605; hg19: chrX-153296070;