rs387906497

Variant names:

• chrX-153725248-GGCAGCCAGCCCAGGTGACATGCCGGT-G
• rs387906497
• NM_000033.4:c.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000033.4(ABCD1):​c.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 25)
• Consequence: ABCD1 NM_000033.4 frameshift, start_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 2.78
• Publications: 3 publications found

Genes affected

ABCD1 (HGNC:61): (ATP binding cassette subfamily D member 1) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein is likely involved in the peroxisomal transport or catabolism of very long chain fatty acids. Defects in this gene have been identified as the underlying cause of adrenoleukodystrophy, an X-chromosome recessively inherited demyelinating disorder of the nervous system. [provided by RefSeq, Jul 2008]

ABCD1 Gene-Disease associations (from GenCC):

• adrenoleukodystrophy

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, G2P
• X-linked cerebral adrenoleukodystrophy

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet
• hereditary spastic paraplegia

  Inheritance: XL Classification: STRONG Submitted by: Genomics England PanelApp
• Hirschsprung disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• adrenomyeloneuropathy

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 513 pathogenic variants in the truncated region.
• PP5: Variant X-153725248-GGCAGCCAGCCCAGGTGACATGCCGGT-G is Pathogenic according to our data. Variant chrX-153725248-GGCAGCCAGCCCAGGTGACATGCCGGT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 11317.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000033.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ABCD1	NM_000033.4	MANE Select	c.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC	p.Met1fs	frameshift start_lost	Exon 1 of 10	NP_000024.2
	ABCD1	NM_000033.4	MANE Select	c.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC		5_prime_UTR	Exon 1 of 10	NP_000024.2
	ABCD1	NM_001440747.1		c.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC	p.Met1fs	frameshift start_lost	Exon 1 of 11	NP_001427676.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ABCD1	ENST00000218104.6	TSL:1 MANE Select	c.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC	p.Met1fs	frameshift start_lost	Exon 1 of 10	ENSP00000218104.3
	ABCD1	ENST00000218104.6	TSL:1 MANE Select	c.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC		5_prime_UTR	Exon 1 of 10	ENSP00000218104.3

Frequencies

GnomAD3 genomes Cov.: 25

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 25

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
2	-	-	Adrenoleukodystrophy (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.8
Mutation Taster		=23/177	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs387906497; hg19: chrX-152990703;