rs397507438

Variant names:

• chr2-27313032-GGCCTCTCTGGTGTTCCTGCAGACCCC-G
• rs397507438
• NM_002437.5:c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_002437.5(MPV17):​c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC​(p.Arg41ProfsTer63) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. R41R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MPV17 NM_002437.5 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 5.19
• Publications: 1 publications found

Genes affected

MPV17 (HGNC:7224): (mitochondrial inner membrane protein MPV17) This gene encodes a mitochondrial inner membrane protein that is implicated in the metabolism of reactive oxygen species. Mutations in this gene have been associated with the hepatocerebral form of mitochondrial DNA depletion syndrome (MDDS). [provided by RefSeq, Jul 2008]

MPV17 Gene-Disease associations (from GenCC):

• mitochondrial disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• mitochondrial DNA depletion syndrome 6 (hepatocerebral type)

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics, Orphanet
• Charcot-Marie-Tooth disease, axonal, type 2EE

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-27313032-GGCCTCTCTGGTGTTCCTGCAGACCCC-G is Pathogenic according to our data. Variant chr2-27313032-GGCCTCTCTGGTGTTCCTGCAGACCCC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 16163.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002437.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MPV17	NM_002437.5	MANE Select	c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC	p.Arg41ProfsTer63	frameshift	Exon 3 of 8	NP_002428.1	P39210

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MPV17	ENST00000380044.6	TSL:1 MANE Select	c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC	p.Arg41ProfsTer63	frameshift	Exon 3 of 8	ENSP00000369383.1	P39210
	MPV17	ENST00000233545.6	TSL:1	c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC	p.Arg41ProfsTer63	frameshift	Exon 2 of 7	ENSP00000233545.2	P39210
	MPV17	ENST00000403262.6	TSL:1	c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC	p.Arg41ProfsTer63	frameshift	Exon 3 of 8	ENSP00000385671.1	B5MCF8

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.2
Mutation Taster		=5/195	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397507438; hg19: chr2-27535899;