rs397508103
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1_StrongPS3PP5_Very_Strong
The NM_000218.3(KCNQ1):c.1892_1911delCCAGAGAGGGCGGGGCCCAC(p.Pro631HisfsTer14) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV002719171: Ambry Internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). Based on the majority of available evidence to date, this variant is likely to be pathogenic. no". Synonymous variant affecting the same amino acid position (i.e. P631P) has been classified as Likely benign. The gene KCNQ1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000218.3 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000218.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNQ1 | MANE Select | c.1892_1911delCCAGAGAGGGCGGGGCCCAC | p.Pro631HisfsTer14 | frameshift | Exon 16 of 16 | NP_000209.2 | |||
| KCNQ1 | c.1796_1815delCCAGAGAGGGCGGGGCCCAC | p.Pro599HisfsTer14 | frameshift | Exon 15 of 15 | NP_001393765.1 | ||||
| KCNQ1 | c.1622_1641delCCAGAGAGGGCGGGGCCCAC | p.Pro541HisfsTer14 | frameshift | Exon 17 of 17 | NP_001393766.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNQ1 | TSL:1 MANE Select | c.1892_1911delCCAGAGAGGGCGGGGCCCAC | p.Pro631HisfsTer14 | frameshift | Exon 16 of 16 | ENSP00000155840.2 | P51787-1 | ||
| KCNQ1 | TSL:1 | c.1511_1530delCCAGAGAGGGCGGGGCCCAC | p.Pro504HisfsTer14 | frameshift | Exon 16 of 16 | ENSP00000334497.5 | P51787-2 | ||
| KCNQ1 | c.1889_1908delCCAGAGAGGGCGGGGCCCAC | p.Pro630HisfsTer14 | frameshift | Exon 16 of 16 | ENSP00000581056.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.