rs397508103
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_ModeratePM2PP5_Very_Strong
The NM_000218.3(KCNQ1):c.1892_1911delCCAGAGAGGGCGGGGCCCAC(p.Pro631HisfsTer14) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
NM_000218.3 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes
GnomAD4 genome
ClinVar
Submissions by phenotype
Long QT syndrome Pathogenic:2
This variant deletes 20 nucleotides in exon 16 of the KCNQ1 gene, creating a frameshift in the last exon. The mutant transcript is expected to escape nonsense-mediated decay and be expressed as a protein product containing altered C-terminal sequence. To our knowledge, functional studies have not been reported for this variant. This variant has been reported in a few unrelated individuals affected with long QT syndrome (PMID: 26669661, 27379800, 32893267). This variant has also been observed in compound heterozygous state in two unrelated individuals, one affected with Jervell and Lange-Nielsen syndrome (PMID: 10024302) and the other affected with early-onset sudden cardiac arrest, ventricular fibrillation, congenital deafness, and with a family history of long QT syndrome (communication with an external laboratory; ClinVar SCV002719171.1). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Truncation variants occurring downstream of this variant are known to cause long QT syndrome (ClinVar). One of these variants, p.Arg632Glnfs*20 (ClinVar variation ID 53027), has been shown to cause protein trafficking defect due to endoplasmic reticulum (ER) retention signal introduced by the frameshift. A similar ER retention signal is also present in the variant p.Pro631Hisfs*14. Based on the available evidence, this variant is classified as Likely Pathogenic. -
This sequence change creates a premature translational stop signal (p.Pro631Hisfs*14) in the KCNQ1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 46 amino acid(s) of the KCNQ1 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Jervell and Lange-Nielsen syndrome (PMID: 10024302). This variant is also known as 1892del20. ClinVar contains an entry for this variant (Variation ID: 53025). This variant disrupts a region of the KCNQ1 protein in which other variant(s) (p.Arg632Glufs*34, p.Arg632Lysfs*20) have been determined to be pathogenic (PMID: 16414944, 22739119; internal data). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
not provided Pathogenic:1Other:1
The c.1892_1911del pathogenic variant in the KCNQ1 gene has been reported in one family with Jervell Lange-Nielsen syndrome (JLNS) (Neyroud et al., 1999). Neyroud et al. reported c.1892_1911del (denoted 1892del20 due to alternate nomenclature) in one family where this variant was paternally inherited; no second variant was identified in the proband. This variant causes a shift in reading frame starting at codon Proline 631, changing it to a Histidine, and creating a premature stop codon at position 14 of the new reading frame, denoted p.Pro631HisfsX14. This variant is expected to result in either an abnormal, truncated protein product or loss of protein from this allele through nonsense-mediated mRNA decay. Other frameshift variants in the KCNQ1 gene have been reported in association with LQTS and JLNS. -
KCNQ1: PM2, PS4:Moderate, PVS1:Moderate -
Beckwith-Wiedemann syndrome;C1837014:Atrial fibrillation, familial, 3;C1865019:Short QT syndrome type 2;C4551509:Jervell and Lange-Nielsen syndrome 1;C4551647:Long QT syndrome 1 Pathogenic:1
- -
Jervell and Lange-Nielsen syndrome 1 Pathogenic:1
- -
KCNQ1-related disorder Pathogenic:1
The KCNQ1 c.1892_1911del20 variant is predicted to result in a frameshift and premature protein termination (p.Pro631Hisfs*14). This variant was reported in multiple individuals with long QT syndrome (Table S1, Itoh et al. 2015. PubMed ID: 26669661; Samol et al. 2016. PubMed ID: 27379800; Table S4, Walsh et al. 2021. PubMed ID: 32893267). This variant was also reported in an individual with Jervell and Lange-Nielsen syndrome; however, a second plausible causative variant was not identified (described as 1892del20, Neyroud et al. 1999. PubMed ID: 10024302). This variant has not been reported in a large population database, indicating this variant is rare. This variant is located in the terminal exon and nearby frameshift variants have been documented in individuals with long QT syndrome (Napolitano et al. 2005. PubMed ID: 16414944). Taken together, this variant is interpreted as pathogenic. -
Cardiovascular phenotype Pathogenic:1
The c.1892_1911del20 variant, located in coding exon 16 of the KCNQ1 gene, results from a deletion of 20 nucleotides at nucleotide positions 1892 to 1911, causing a translational frameshift with a predicted alternate stop codon (p.P631Hfs*14). This frameshift occurs at the 3' terminus of KCNQ1, is not expected to trigger nonsense-mediated mRNA decay, and impacts only the last 46 amino acids of the protein. However, this alteration has been previously reported in long QT syndrome cohorts (Itoh H et al. Eur. J. Hum. Genet., 2016 08;24:1160-6; Samol A et al. PLoS ONE, 2016 Jul;11:e0158085). This deletion allele has also been detected in the heterozygous state in a patient with autosomal recessive Jervell and Lange-Nielsen syndrome, though a second KCNQ1 alteration was not identified (Neyroud N et al. Circ. Res., 1999 Feb;84:290-7). In addition, there is a putative endoplasmic reticulum (ER) retention signal located in the 3' terminus of this alteration that is not present in wild-type KCNQ1; the presence of similar ER retention signals in another frameshift alteration (p.R632Qfs*20) has been shown to result in a trafficking defect (Sato A et al. J. Biol. Chem., 2009 Dec;284:35122-33; Ambry Internal data). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -
Cardiac arrhythmia Pathogenic:1
This variant deletes 20 nucleotides in exon 16 of the KCNQ1 gene, creating a frameshift in the last exon. The mutant transcript is expected to escape nonsense-mediated decay and be expressed as a protein product containing altered C-terminal sequence. To our knowledge, functional studies have not been reported for this variant. This variant has been reported in a few unrelated individuals affected with long QT syndrome (PMID: 26669661, 27379800, 32893267). This variant has also been observed in compound heterozygous state in two unrelated individuals, one affected with Jervell and Lange-Nielsen syndrome (PMID: 10024302) and the other affected with early-onset sudden cardiac arrest, ventricular fibrillation, congenital deafness, and with a family history of long QT syndrome (communication with an external laboratory; ClinVar SCV002719171.1). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Truncation variants occurring downstream of this variant are known to cause long QT syndrome (ClinVar). One of these variants, p.Arg632GlnfsTer20 (ClinVar variation ID 53027), has been shown to cause a protein trafficking defect due to endoplasmic reticulum (ER) retention signal introduced by the frameshift. A similar ER retention signal is also present in the variant p.Pro631HisfsTer14. Based on the available evidence, this variant is classified as Likely Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at