rs397514254

Variant names:

• chr19-44908706-G-GCGGCGAGGTGCAGGCCATGCT
• rs397514254
• NM_000041.4:c.415_435dupGAGGTGCAGGCCATGCTCGGC

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1 PM2 PM4 PP5

The NM_000041.4(APOE):​c.415_435dupGAGGTGCAGGCCATGCTCGGC​(p.Glu139_Gly145dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000071 in 1,407,626 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 7.1e-7 (0 hom.)
• Consequence: APOE NM_000041.4 conservative_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.15

Genes affected

APOE (HGNC:613): (apolipoprotein E) The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. [provided by RefSeq, Jun 2016]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM1: In a repeat 4 (size 21) in uniprot entity APOE_HUMAN there are 6 pathogenic changes around while only 1 benign (86%) in NM_000041.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000041.4.
• PP5: Variant 19-44908706-G-GCGGCGAGGTGCAGGCCATGCT is Pathogenic according to our data. Variant chr19-44908706-G-GCGGCGAGGTGCAGGCCATGCT is described in ClinVar as [Pathogenic]. Clinvar id is 17853.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
APOE	NM_000041.4	c.415_435dupGAGGTGCAGGCCATGCTCGGC	p.Glu139_Gly145dup	conservative_inframe_insertion	Exon 4 of 4	ENST00000252486.9	NP_000032.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
APOE	ENST00000252486.9	c.415_435dupGAGGTGCAGGCCATGCTCGGC	p.Glu139_Gly145dup	conservative_inframe_insertion	Exon 4 of 4	1	NM_000041.4	ENSP00000252486.3
APOE	ENST00000425718.1	c.415_435dupGAGGTGCAGGCCATGCTCGGC	p.Glu139_Gly145dup	conservative_inframe_insertion	Exon 3 of 3	1		ENSP00000410423.1
APOE	ENST00000434152.5	c.493_513dupGAGGTGCAGGCCATGCTCGGC	p.Glu165_Gly171dup	conservative_inframe_insertion	Exon 4 of 4	2		ENSP00000413653.2
APOE	ENST00000446996.5	c.415_435dupGAGGTGCAGGCCATGCTCGGC	p.Glu139_Gly145dup	conservative_inframe_insertion	Exon 4 of 4	2		ENSP00000413135.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 7.10e-7 AC: 1 AN: 1407626 Hom.: 0 Cov.: 33 AF XY: 0.00000144 AC XY: 1 AN XY: 695500

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.22e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Familial type 3 hyperlipoproteinemia Pathogenic:1

Apr 01, 2004

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397514254; hg19: chr19-45411963;