rs397514818

Variant names:

• chr9-132905875-C-CCCGCAGGGCTTTCATCAGCACTG
• rs118203557
• NM_000368.5:c.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG

Your query was ambiguous. Multiple possible variants found:

• chr9-132905875-C-CCCGCAGGGCTTTCATCAGCACTG
• chr9-132905875-CCCGCAGGGCTTTCATCAGCACTG-C

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000368.5(TSC1):​c.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG​(p.Gly568AlafsTer69) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TSC1 NM_000368.5 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2 O:1
• Conservation: PhyloP100: 1.95

Genes affected

TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 9-132905875-C-CCCGCAGGGCTTTCATCAGCACTG is Pathogenic according to our data. Variant chr9-132905875-C-CCCGCAGGGCTTTCATCAGCACTG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 48813.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC1	NM_000368.5	c.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG	p.Gly568AlafsTer69	frameshift_variant	Exon 15 of 23	ENST00000298552.9	NP_000359.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC1	ENST00000298552.9	c.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG	p.Gly568AlafsTer69	frameshift_variant	Exon 15 of 23	1	NM_000368.5	ENSP00000298552.3
TSC1	ENST00000490179.4	c.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG	p.Gly568AlafsTer69	frameshift_variant	Exon 16 of 24	3		ENSP00000495533.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:1

Apr 17, 2023

Clinical Genetics Laboratory, Skane University Hospital Lund

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Tuberous sclerosis 1 Pathogenic:1

Sep 25, 2020

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Gly568Alafs*69) in the TSC1 gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has been observed in individual(s) with tuberous sclerosis complex (PMID: 10340649, 16114042). In at least one individual the variant was observed to be de novo. ClinVar contains an entry for this variant (Variation ID: 48813). Loss-of-function variants in TSC1 are known to be pathogenic (PMID: 10227394, 17304050). For these reasons, this variant has been classified as Pathogenic. -

Tuberous sclerosis syndrome Other:1

-

Tuberous sclerosis database (TSC1)

Significance: not provided

Review Status: no classification provided

Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs118203557; hg19: chr9-135781262;