rs557364463

Variant names:

• chr10-87960840-ATTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT-A
• rs557364463
• NM_000314.8:c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

This summary comes from the ClinGen Evidence Repository: PTEN c.802-51_802-14del (IVS7-51_IVS7-14del) meets criteria to be classified as benign for PTEN Hamartoma Tumor syndrome in an autosomal dominant manner using modified ACMG criteria (PMID 30311380). Please see a summary of the rules and criteria codes in the “PTEN ACMG Specifications Summary” document (assertion method column).BA1: Allele frequency of 0.01931 (1.931%, 2747/142,290 alleles) in the global gnomAD cohort. (PMID 27535533) LINK:https://erepo.genome.network/evrepo/ui/classification/CA338721/MONDO:0017623/003

• Frequency:
  • Genomes: 𝑓 0.018 (91 hom., cov: 31)
  • Exomes 𝑓: 0.0017 (6 hom.)
  • Failed GnomAD Quality Control
• Consequence: PTEN NM_000314.8 intron
• Clinical Significance: Benign reviewed by expert panel U:1 B:13
• Conservation: PhyloP100: 1.40
• Publications: 1 publications found

Genes affected

PTEN (HGNC:9588): (phosphatase and tensin homolog) This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]

PTEN Gene-Disease associations (from GenCC):

• Cowden syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• PTEN hamartoma tumor syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• macrocephaly-autism syndrome

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Orphanet
• renal cell carcinoma

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• leiomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• activated PI3K-delta syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Bannayan-Riley-Ruvalcaba syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Cowden disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Lhermitte-Duclos disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Proteus-like syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• glioma susceptibility 2

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Specifications for PTEN are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: For more information check the summary or visit ClinGen Evidence Repository.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000314.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PTEN	NM_000314.8	MANE Select	c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT		intron	N/A	NP_000305.3
	PTEN	NM_001304717.5		c.1321-51_1321-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT		intron	N/A	NP_001291646.4
	PTEN	NM_001304718.2		c.211-51_211-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT		intron	N/A	NP_001291647.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PTEN	ENST00000371953.8	TSL:1 MANE Select	c.802-53_802-16delTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT		intron	N/A	ENSP00000361021.3	P60484-1
	PTEN	ENST00000693560.1		c.1321-53_1321-16delTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT		intron	N/A	ENSP00000509861.1	A0A8I5KSF9
	PTEN	ENST00000700029.2		c.895-53_895-16delTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT		intron	N/A	ENSP00000514759.2	A0A8V8TPK6

Frequencies

GnomAD3 genomes AF: 0.0182 AC: 2758 AN: 151158 Hom.: 90 Cov.: 31

Gnomad AFR AF: 0.0627

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00844

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00637

Gnomad NFE AF: 0.000221

Gnomad OTH AF: 0.0139

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00166 AC: 2244 AN: 1354456 Hom.: 6 AF XY: 0.00145 AC XY: 971 AN XY: 670666

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0626 AC: 1806 AN: 28858

American (AMR) AF: 0.00443 AC: 133 AN: 30042

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23952

East Asian (EAS) AF: 0.00 AC: 0 AN: 35310

South Asian (SAS) AF: 0.0000685 AC: 5 AN: 72968

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 47724

Middle Eastern (MID) AF: 0.00387 AC: 20 AN: 5164

European-Non Finnish (NFE) AF: 0.0000607 AC: 64 AN: 1054558

Other (OTH) AF: 0.00387 AC: 216 AN: 55880

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0182 AC: 2757 AN: 151260 Hom.: 91 Cov.: 31 AF XY: 0.0173 AC XY: 1282 AN XY: 73914

African (AFR) AF: 0.0625 AC: 2584 AN: 41336

American (AMR) AF: 0.00843 AC: 128 AN: 15186

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5170

South Asian (SAS) AF: 0.00 AC: 0 AN: 4796

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10208

Middle Eastern (MID) AF: 0.00342 AC: 1 AN: 292

European-Non Finnish (NFE) AF: 0.000221 AC: 15 AN: 67794

Other (OTH) AF: 0.0138 AC: 29 AN: 2098

Alfa AF: 0.0129 Hom.: 5

ClinVar

ClinVar submissions

Significance: Benign

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
-	-	3	Hereditary cancer-predisposing syndrome (3)
-	-	3	not specified (3)
-	1	1	Cowden syndrome 1 (2)
-	-	2	not provided (2)
-	-	2	PTEN hamartoma tumor syndrome (2)
-	-	1	Breast and/or ovarian cancer (1)
-	-	1	Macrocephaly-autism syndrome;C2751642:Glioma susceptibility 2;C2931456:Familial prostate cancer;C3551915:Familial meningioma;CN072330:Cowden syndrome 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs557364463;

hg19: chr10-89720597;