rs557364463
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1
This summary comes from the ClinGen Evidence Repository: PTEN c.802-51_802-14del (IVS7-51_IVS7-14del) meets criteria to be classified as benign for PTEN Hamartoma Tumor syndrome in an autosomal dominant manner using modified ACMG criteria (PMID 30311380). Please see a summary of the rules and criteria codes in the “PTEN ACMG Specifications Summary” document (assertion method column).BA1: Allele frequency of 0.01931 (1.931%, 2747/142,290 alleles) in the global gnomAD cohort. (PMID 27535533) LINK:https://erepo.genome.network/evrepo/ui/classification/CA338721/MONDO:0017623/003
Frequency
Consequence
NM_000314.8 intron
Scores
Clinical Significance
Conservation
Publications
- Cowden syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- PTEN hamartoma tumor syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- macrocephaly-autism syndromeInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Orphanet
- renal cell carcinomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- leiomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- activated PI3K-delta syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Bannayan-Riley-Ruvalcaba syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Cowden diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Lhermitte-Duclos diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Proteus-like syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- glioma susceptibility 2Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000314.8. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PTEN | MANE Select | c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT | intron | N/A | NP_000305.3 | ||||
| PTEN | c.1321-51_1321-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT | intron | N/A | NP_001291646.4 | |||||
| PTEN | c.211-51_211-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT | intron | N/A | NP_001291647.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PTEN | TSL:1 MANE Select | c.802-53_802-16delTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT | intron | N/A | ENSP00000361021.3 | P60484-1 | |||
| PTEN | c.1321-53_1321-16delTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT | intron | N/A | ENSP00000509861.1 | A0A8I5KSF9 | ||||
| PTEN | c.895-53_895-16delTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT | intron | N/A | ENSP00000514759.2 | A0A8V8TPK6 |
Frequencies
GnomAD3 genomes AF: 0.0182 AC: 2758AN: 151158Hom.: 90 Cov.: 31 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00166 AC: 2244AN: 1354456Hom.: 6 AF XY: 0.00145 AC XY: 971AN XY: 670666 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0182 AC: 2757AN: 151260Hom.: 91 Cov.: 31 AF XY: 0.0173 AC XY: 1282AN XY: 73914 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.