chr10-87960840-ATTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT-A
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1
This summary comes from the ClinGen Evidence Repository: PTEN c.802-51_802-14del (IVS7-51_IVS7-14del) meets criteria to be classified as benign for PTEN Hamartoma Tumor syndrome in an autosomal dominant manner using modified ACMG criteria (PMID 30311380). Please see a summary of the rules and criteria codes in the “PTEN ACMG Specifications Summary” document (assertion method column).BA1: Allele frequency of 0.01931 (1.931%, 2747/142,290 alleles) in the global gnomAD cohort. (PMID 27535533) LINK:https://erepo.genome.network/evrepo/ui/classification/CA338721/MONDO:0017623/003
Frequency
Consequence
NM_000314.8 intron
Scores
Clinical Significance
Conservation
Publications
- Cowden syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P
- PTEN hamartoma tumor syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- macrocephaly-autism syndromeInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Orphanet
- renal cell carcinomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- leiomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- activated PI3K-delta syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Bannayan-Riley-Ruvalcaba syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Cowden diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Lhermitte-Duclos diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Proteus-like syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- glioma susceptibility 2Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| PTEN | NM_000314.8 | c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT | intron_variant | Intron 7 of 8 | ENST00000371953.8 | NP_000305.3 | ||
| PTEN | NM_001304717.5 | c.1321-51_1321-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT | intron_variant | Intron 8 of 9 | NP_001291646.4 | |||
| PTEN | NM_001304718.2 | c.211-51_211-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT | intron_variant | Intron 7 of 8 | NP_001291647.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| PTEN | ENST00000371953.8 | c.802-53_802-16delTTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT | intron_variant | Intron 7 of 8 | 1 | NM_000314.8 | ENSP00000361021.3 |
Frequencies
GnomAD3 genomes AF: 0.0182 AC: 2758AN: 151158Hom.: 90 Cov.: 31 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00166 AC: 2244AN: 1354456Hom.: 6 AF XY: 0.00145 AC XY: 971AN XY: 670666 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0182 AC: 2757AN: 151260Hom.: 91 Cov.: 31 AF XY: 0.0173 AC XY: 1282AN XY: 73914 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not specified Benign:3
- -
- -
- -
Hereditary cancer-predisposing syndrome Benign:3
This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
- -
- -
Cowden syndrome 1 Uncertain:1Benign:1
This variant is considered benign. This variant is intronic and is not expected to impact mRNA splicing. This variant has been observed at a population frequency that is significantly greater than expected given the associated disease prevalence and penetrance. -
- -
PTEN hamartoma tumor syndrome Benign:2
PTEN c.802-51_802-14del (IVS7-51_IVS7-14del) meets criteria to be classified as benign for PTEN Hamartoma Tumor syndrome in an autosomal dominant manner using modified ACMG criteria (PMID 30311380). Please see a summary of the rules and criteria codes in the "PTEN ACMG Specifications Summary" document (assertion method column). BA1: Allele frequency of 0.01931 (1.931%, 2747/142,290 alleles) in the global gnomAD cohort. (PMID 27535533) -
- -
not provided Benign:2
- -
This variant is associated with the following publications: (PMID: 11986403) -
Breast and/or ovarian cancer Benign:1
- -
Macrocephaly-autism syndrome;C2751642:Glioma susceptibility 2;C2931456:Familial prostate cancer;C3551915:Familial meningioma;CN072330:Cowden syndrome 1 Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at