chr10-87960840-ATTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTT-A
Variant summary
Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BA1
This summary comes from the ClinGen Evidence Repository: PTEN c.802-51_802-14del (IVS7-51_IVS7-14del) meets criteria to be classified as benign for PTEN Hamartoma Tumor syndrome in an autosomal dominant manner using modified ACMG criteria (PMID 30311380). Please see a summary of the rules and criteria codes in the “PTEN ACMG Specifications Summary” document (assertion method column).BA1: Allele frequency of 0.01931 (1.931%, 2747/142,290 alleles) in the global gnomAD cohort. (PMID 27535533) LINK:https://erepo.genome.network/evrepo/ui/classification/CA338721/MONDO:0017623/003
Frequency
Consequence
NM_000314.8 intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Benign. Variant got -8 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PTEN | NM_000314.8 | c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT | intron_variant | Intron 7 of 8 | ENST00000371953.8 | NP_000305.3 | ||
PTEN | NM_001304717.5 | c.1321-51_1321-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT | intron_variant | Intron 8 of 9 | NP_001291646.4 | |||
PTEN | NM_001304718.2 | c.211-51_211-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT | intron_variant | Intron 7 of 8 | NP_001291647.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0182 AC: 2758AN: 151158Hom.: 90 Cov.: 31
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00166 AC: 2244AN: 1354456Hom.: 6 AF XY: 0.00145 AC XY: 971AN XY: 670666
GnomAD4 genome AF: 0.0182 AC: 2757AN: 151260Hom.: 91 Cov.: 31 AF XY: 0.0173 AC XY: 1282AN XY: 73914
ClinVar
Submissions by phenotype
not specified Benign:3
- -
- -
- -
Hereditary cancer-predisposing syndrome Benign:3
- -
- -
This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
PTEN hamartoma tumor syndrome Benign:2
PTEN c.802-51_802-14del (IVS7-51_IVS7-14del) meets criteria to be classified as benign for PTEN Hamartoma Tumor syndrome in an autosomal dominant manner using modified ACMG criteria (PMID 30311380). Please see a summary of the rules and criteria codes in the "PTEN ACMG Specifications Summary" document (assertion method column). BA1: Allele frequency of 0.01931 (1.931%, 2747/142,290 alleles) in the global gnomAD cohort. (PMID 27535533) -
- -
not provided Benign:2
- -
This variant is associated with the following publications: (PMID: 11986403) -
Cowden syndrome 1 Uncertain:1
- -
Breast and/or ovarian cancer Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at