rs571303442

Variant names:

• chr14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-A
• rs571303442
• NM_024824.5:c.2204+17_2204+41delGTTTTTCTCATGTCAGTTCAAATTC

Your query was ambiguous. Multiple possible variants found:

• chr14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-A
• chr14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-ATTCAAATTCGTTTTTCTCATGTCAGTTCAAATTCGTTTTTCTCATGTCAG

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP6 BS2

The ENST00000251038.10(ZC3H14):​c.2204+8_2204+32delTTCAAATTCGTTTTTCTCATGTCAG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0128 in 1,612,820 control chromosomes in the GnomAD database, including 162 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.011 (14 hom., cov: 31)
  • Exomes 𝑓: 0.013 (148 hom.)
• Consequence: ZC3H14 ENST00000251038.10 splice_region, intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1 B:4
• Conservation: PhyloP100: 1.09
• Publications: 1 publications found

Genes affected

ZC3H14 (HGNC:20509): (zinc finger CCCH-type containing 14) The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]

ZC3H14 Gene-Disease associations (from GenCC):

• autosomal recessive non-syndromic intellectual disability

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• intellectual disability

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen
• intellectual disability, autosomal recessive 56

  Inheritance: AR, AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP6: Variant 14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-A is Benign according to our data. Variant chr14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-A is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 254279.
• BS2: High Homozygotes in GnomAd4 at 14 AR,AD gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000251038.10. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZC3H14	NM_024824.5	MANE Select	c.2204+17_2204+41delGTTTTTCTCATGTCAGTTCAAATTC		intron	N/A	NP_079100.2
	ZC3H14	NM_001160103.2		c.2201+17_2201+41delGTTTTTCTCATGTCAGTTCAAATTC		intron	N/A	NP_001153575.1	Q6PJT7-2
	ZC3H14	NM_001326310.2		c.2189+17_2189+41delGTTTTTCTCATGTCAGTTCAAATTC		intron	N/A	NP_001313239.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZC3H14	ENST00000251038.10	TSL:1 MANE Select	c.2204+8_2204+32delTTCAAATTCGTTTTTCTCATGTCAG		splice_region intron	N/A	ENSP00000251038.5	Q6PJT7-1
	ZC3H14	ENST00000556000.5	TSL:1	c.1946+8_1946+32delTTCAAATTCGTTTTTCTCATGTCAG		splice_region intron	N/A	ENSP00000451054.1	H0YJA2
	ZC3H14	ENST00000302216.12	TSL:1	c.1733+8_1733+32delTTCAAATTCGTTTTTCTCATGTCAG		splice_region intron	N/A	ENSP00000307025.8	Q6PJT7-3

Frequencies

GnomAD3 genomes AF: 0.0111 AC: 1691 AN: 152172 Hom.: 14 Cov.: 31

Gnomad AFR AF: 0.0127

Gnomad AMI AF: 0.0493

Gnomad AMR AF: 0.00504

Gnomad ASJ AF: 0.0291

Gnomad EAS AF: 0.000192

Gnomad SAS AF: 0.00289

Gnomad FIN AF: 0.00311

Gnomad MID AF: 0.0253

Gnomad NFE AF: 0.0127

Gnomad OTH AF: 0.0110

GnomAD2 exomes AF: 0.00960 AC: 2413 AN: 251242 AF XY: 0.00978

Gnomad AFR exome AF: 0.0137

Gnomad AMR exome AF: 0.00411

Gnomad ASJ exome AF: 0.0281

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00342

Gnomad NFE exome AF: 0.0126

Gnomad OTH exome AF: 0.0104

GnomAD4 exome AF: 0.0130 AC: 19027 AN: 1460530 Hom.: 148 AF XY: 0.0128 AC XY: 9266 AN XY: 726658

African (AFR) AF: 0.0128 AC: 428 AN: 33444

American (AMR) AF: 0.00447 AC: 200 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.0287 AC: 750 AN: 26118

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39692

South Asian (SAS) AF: 0.00590 AC: 509 AN: 86224

European-Finnish (FIN) AF: 0.00382 AC: 204 AN: 53414

Middle Eastern (MID) AF: 0.0154 AC: 89 AN: 5768

European-Non Finnish (NFE) AF: 0.0145 AC: 16111 AN: 1110792

Other (OTH) AF: 0.0122 AC: 735 AN: 60356

GnomAD4 genome AF: 0.0111 AC: 1693 AN: 152290 Hom.: 14 Cov.: 31 AF XY: 0.0104 AC XY: 776 AN XY: 74482

African (AFR) AF: 0.0127 AC: 528 AN: 41554

American (AMR) AF: 0.00503 AC: 77 AN: 15296

Ashkenazi Jewish (ASJ) AF: 0.0291 AC: 101 AN: 3468

East Asian (EAS) AF: 0.000193 AC: 1 AN: 5184

South Asian (SAS) AF: 0.00310 AC: 15 AN: 4832

European-Finnish (FIN) AF: 0.00311 AC: 33 AN: 10620

Middle Eastern (MID) AF: 0.0272 AC: 8 AN: 294

European-Non Finnish (NFE) AF: 0.0127 AC: 862 AN: 68016

Other (OTH) AF: 0.0109 AC: 23 AN: 2114

Alfa AF: 0.0119 Hom.: 1

Asia WGS AF: 0.00144 AC: 5 AN: 3478

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
1	1	1	Intellectual disability, autosomal recessive 56 (3)
-	-	3	not provided (3)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs571303442; hg19: chr14-89077291;