rs571303442

Variant names:

• chr14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-A
• rs571303442
• NM_024824.5:c.2204+17_2204+41delGTTTTTCTCATGTCAGTTCAAATTC

Your query was ambiguous. Multiple possible variants found:

• chr14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-A
• chr14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-ATTCAAATTCGTTTTTCTCATGTCAGTTCAAATTCGTTTTTCTCATGTCAG

Variant summary

Our verdict is Benign. Variant got -12 ACMG points: 0P and 12B. BP6_Very_Strong BS2

The ENST00000251038.10(ZC3H14):​c.2204+8_2204+32delTTCAAATTCGTTTTTCTCATGTCAG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0128 in 1,612,820 control chromosomes in the GnomAD database, including 162 homozygotes. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.011 (14 hom., cov: 31)
  • Exomes 𝑓: 0.013 (148 hom.)
• Consequence: ZC3H14 ENST00000251038.10 splice_region, intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1 B:4
• Conservation: PhyloP100: 1.09

Genes affected

ZC3H14 (HGNC:20509): (zinc finger CCCH-type containing 14) The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]

ACMG classification

Verdict is Benign. Variant got -12 ACMG points.

• BP6: Variant 14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-A is Benign according to our data. Variant chr14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-A is described in ClinVar as [Benign]. Clinvar id is 254279.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAd4 at 14 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ZC3H14	NM_024824.5	c.2204+17_2204+41delGTTTTTCTCATGTCAGTTCAAATTC		intron_variant	Intron 16 of 16	ENST00000251038.10	NP_079100.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ZC3H14	ENST00000251038.10	c.2204+8_2204+32delTTCAAATTCGTTTTTCTCATGTCAG		splice_region_variant, intron_variant	Intron 16 of 16	1	NM_024824.5	ENSP00000251038.5

Frequencies

GnomAD3 genomes AF: 0.0111 AC: 1691 AN: 152172 Hom.: 14 Cov.: 31

Gnomad AFR AF: 0.0127

Gnomad AMI AF: 0.0493

Gnomad AMR AF: 0.00504

Gnomad ASJ AF: 0.0291

Gnomad EAS AF: 0.000192

Gnomad SAS AF: 0.00289

Gnomad FIN AF: 0.00311

Gnomad MID AF: 0.0253

Gnomad NFE AF: 0.0127

Gnomad OTH AF: 0.0110

GnomAD3 exomes AF: 0.00960 AC: 2413 AN: 251242 Hom.: 19 AF XY: 0.00978 AC XY: 1328 AN XY: 135790

Gnomad AFR exome AF: 0.0137

Gnomad AMR exome AF: 0.00411

Gnomad ASJ exome AF: 0.0281

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00624

Gnomad FIN exome AF: 0.00342

Gnomad NFE exome AF: 0.0126

Gnomad OTH exome AF: 0.0104

GnomAD4 exome AF: 0.0130 AC: 19027 AN: 1460530 Hom.: 148 AF XY: 0.0128 AC XY: 9266 AN XY: 726658

Gnomad4 AFR exome AF: 0.0128

Gnomad4 AMR exome AF: 0.00447

Gnomad4 ASJ exome AF: 0.0287

Gnomad4 EAS exome AF: 0.0000252

Gnomad4 SAS exome AF: 0.00590

Gnomad4 FIN exome AF: 0.00382

Gnomad4 NFE exome AF: 0.0145

Gnomad4 OTH exome AF: 0.0122

GnomAD4 genome AF: 0.0111 AC: 1693 AN: 152290 Hom.: 14 Cov.: 31 AF XY: 0.0104 AC XY: 776 AN XY: 74482

Gnomad4 AFR AF: 0.0127

Gnomad4 AMR AF: 0.00503

Gnomad4 ASJ AF: 0.0291

Gnomad4 EAS AF: 0.000193

Gnomad4 SAS AF: 0.00310

Gnomad4 FIN AF: 0.00311

Gnomad4 NFE AF: 0.0127

Gnomad4 OTH AF: 0.0109

Alfa AF: 0.0119 Hom.: 1

Asia WGS AF: 0.00144 AC: 5 AN: 3478

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:1 Benign:4

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Intellectual disability, autosomal recessive 56 Pathogenic:1 Uncertain:1 Benign:1

Aug 22, 2023

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: research

- -

Dec 02, 2021

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Jan 06, 2020

Reproductive Health Research and Development, BGI Genomics

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: curation

NG_050601.1(NM_024824.4):c.2204+17_2204+41del in ZC3H14 gene has an allele frequency of 0.028 in Ashkenazi Jewish subpopulation in the gnomAD database, including 22 homozygous occurrences. Benign computational verdict because benign prediction from GERP. Pak et al. reported three intellectual disability patients in a consanguineous family with the homozygous of this deletion. Haplotype of the single linkage interval with maximum LOD score of 2.5 in Family-2 (PMID: 21734151). Taken together, we interprete this variant as Benign/Likely benign variant. ACMG/AMP criteria applied: BS1, BS2, BP4, PM3_Supporting, PP1_Strong. -

not provided Benign:3

Jan 01, 2025

CeGaT Center for Human Genetics Tuebingen

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

ZC3H14: BS1, BS2 -

Dec 31, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 20, 2019

Knight Diagnostic Laboratories, Oregon Health and Sciences University

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs571303442; hg19: chr14-89077291;