rs573058662

Variant names:

• chr19-38433741-CCCCAGCCCGCCCCCAGCCCTCCCG-C
• rs573058662
• ENST00000594335.6:n.-78_-55delCCCCAGCCCTCCCGCCCAGCCCGC

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_000540.3(RYR1):​c.-78_-55delCCCCAGCCCTCCCGCCCAGCCCGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0045 (10 hom., cov: 28)
  • Exomes 𝑓: 0.00082 (21 hom.)
  • Failed GnomAD Quality Control
• Consequence: RYR1 NM_000540.3 5_prime_UTR
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 2.43
• Publications: 0 publications found

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

RYR1 Gene-Disease associations (from GenCC):

• malignant hyperthermia, susceptibility to, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, Ambry Genetics
• congenital multicore myopathy with external ophthalmoplegia

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• RYR1-related myopathy

  Inheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
• central core myopathy

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• King-Denborough syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• malignant hyperthermia of anesthesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive centronuclear myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• benign Samaritan congenital myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• congenital myopathy with myasthenic-like onset

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• lethal multiple pterygium syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 19-38433741-CCCCAGCCCGCCCCCAGCCCTCCCG-C is Benign according to our data. Variant chr19-38433741-CCCCAGCCCGCCCCCAGCCCTCCCG-C is described in ClinVar as [Likely_benign]. Clinvar id is 1211621.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RYR1	NM_000540.3	c.-78_-55delCCCCAGCCCTCCCGCCCAGCCCGC		5_prime_UTR_variant	Exon 1 of 106	ENST00000359596.8	NP_000531.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RYR1	ENST00000359596.8	c.-78_-55delCCCCAGCCCTCCCGCCCAGCCCGC		5_prime_UTR_variant	Exon 1 of 106	5	NM_000540.3	ENSP00000352608.2

Frequencies

GnomAD3 genomes AF: 0.00443 AC: 672 AN: 151666 Hom.: 8 Cov.: 28

Gnomad AFR AF: 0.0150

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00277

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000442

Gnomad OTH AF: 0.00336

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000822 AC: 458 AN: 557210 Hom.: 21 AF XY: 0.000583 AC XY: 176 AN XY: 301752

African (AFR) AF: 0.0218 AC: 358 AN: 16426

American (AMR) AF: 0.00105 AC: 37 AN: 35310

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19276

East Asian (EAS) AF: 0.00 AC: 0 AN: 32554

South Asian (SAS) AF: 0.0000315 AC: 2 AN: 63580

European-Finnish (FIN) AF: 0.0000258 AC: 1 AN: 38750

Middle Eastern (MID) AF: 0.000420 AC: 1 AN: 2382

European-Non Finnish (NFE) AF: 0.0000282 AC: 9 AN: 319366

Other (OTH) AF: 0.00169 AC: 50 AN: 29566

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00450 AC: 683 AN: 151774 Hom.: 10 Cov.: 28 AF XY: 0.00442 AC XY: 328 AN XY: 74174

African (AFR) AF: 0.0152 AC: 631 AN: 41408

American (AMR) AF: 0.00276 AC: 42 AN: 15198

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5128

South Asian (SAS) AF: 0.00 AC: 0 AN: 4808

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10552

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000442 AC: 3 AN: 67904

Other (OTH) AF: 0.00333 AC: 7 AN: 2104

Alfa AF: 0.00342 Hom.: 0

Bravo AF: 0.00541

Asia WGS AF: 0.00231 AC: 8 AN: 3472

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Feb 11, 2019

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.4
Mutation Taster		=264/36	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs573058662; hg19: chr19-38924381;