rs573729300

Variant names:

• chr20-48921858-GCGGGGCCGTCAGCCCCCGCCGGGC-G
• rs573729300
• NM_006420.3:c.-24_-1delGTCAGCCCCCGCCGGGCCGGGGCC

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 2P and 6B. PM2 BP6_Moderate BS1

The NM_006420.3(ARFGEF2):​c.-24_-1delGTCAGCCCCCGCCGGGCCGGGGCC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000413 in 1,503,662 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0014 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00030 (1 hom.)
• Consequence: ARFGEF2 NM_006420.3 5_prime_UTR
• Clinical Significance: Likely benign criteria provided, single submitter B:2
• Conservation: PhyloP100: 3.03

Genes affected

ARFGEF2 (HGNC:15853): (ADP ribosylation factor guanine nucleotide exchange factor 2) ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 20-48921858-GCGGGGCCGTCAGCCCCCGCCGGGC-G is Benign according to our data. Variant chr20-48921858-GCGGGGCCGTCAGCCCCCGCCGGGC-G is described in ClinVar as [Likely_benign]. Clinvar id is 418016.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.00144 (219/152010) while in subpopulation AFR AF= 0.00427 (177/41500). AF 95% confidence interval is 0.00375. There are 0 homozygotes in gnomad4. There are 103 alleles in male gnomad4 subpopulation. Median coverage is 32. This position pass quality control queck.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ARFGEF2	NM_006420.3	c.-24_-1delGTCAGCCCCCGCCGGGCCGGGGCC		5_prime_UTR_variant	Exon 1 of 39	ENST00000371917.5	NP_006411.2
ARFGEF2	NM_001410846.1	c.-24_-1delGTCAGCCCCCGCCGGGCCGGGGCC		5_prime_UTR_variant	Exon 1 of 39		NP_001397775.1
ARFGEF2	XM_047439832.1	c.-433_-410delGTCAGCCCCCGCCGGGCCGGGGCC		5_prime_UTR_variant	Exon 1 of 37		XP_047295788.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ARFGEF2	ENST00000371917	c.-24_-1delGTCAGCCCCCGCCGGGCCGGGGCC		5_prime_UTR_variant	Exon 1 of 39	1	NM_006420.3	ENSP00000360985.4

Frequencies

GnomAD3 genomes AF: 0.00144 AC: 219 AN: 151900 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00428

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000524

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000194

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000284

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000383

Gnomad OTH AF: 0.00191

GnomAD3 exomes AF: 0.000455 AC: 54 AN: 118654 Hom.: 0 AF XY: 0.000420 AC XY: 27 AN XY: 64274

Gnomad AFR exome AF: 0.00776

Gnomad AMR exome AF: 0.0000995

Gnomad ASJ exome AF: 0.000138

Gnomad EAS exome AF: 0.000160

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.000268

Gnomad NFE exome AF: 0.000409

Gnomad OTH exome AF: 0.000612

GnomAD4 exome AF: 0.000297 AC: 402 AN: 1351652 Hom.: 1 AF XY: 0.000321 AC XY: 214 AN XY: 666382

Gnomad4 AFR exome AF: 0.00485

Gnomad4 AMR exome AF: 0.000318

Gnomad4 ASJ exome AF: 0.0000427

Gnomad4 EAS exome AF: 0.0000657

Gnomad4 SAS exome AF: 0.0000932

Gnomad4 FIN exome AF: 0.000294

Gnomad4 NFE exome AF: 0.000202

Gnomad4 OTH exome AF: 0.000396

GnomAD4 genome AF: 0.00144 AC: 219 AN: 152010 Hom.: 0 Cov.: 32 AF XY: 0.00139 AC XY: 103 AN XY: 74328

Gnomad4 AFR AF: 0.00427

Gnomad4 AMR AF: 0.000524

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000194

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000284

Gnomad4 NFE AF: 0.000383

Gnomad4 OTH AF: 0.00189

Alfa AF: 0.00102 Hom.: 0

Bravo AF: 0.00159

Asia WGS AF: 0.000289 AC: 1 AN: 3470

ClinVar

Significance: Likely benign

Submissions summary: Benign:2

Revision: criteria provided, single submitter

Submissions by phenotype

ARFGEF2-related disorder Benign:1

Jul 29, 2019

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

not specified Benign:1

Nov 25, 2016

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs573729300; hg19: chr20-47538395;