rs587778382

Variant names:

• chr20-58854492-AGATCCCGACTCCGGGACAGCACCAGCC-A
• rs587778382
• ENST00000676826.2:c.1233_1259delCGACTCCGGGACAGCACCAGCCGATCC

Variant summary

Our verdict is Benign. Variant got -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BS1 BS2

The NM_080425.4(GNAS):​c.1233_1259delCGACTCCGGGACAGCACCAGCCGATCC​(p.Asp412_Pro420del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000846 in 1,578,852 control chromosomes in the GnomAD database, including 7 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0034 (4 hom., cov: 33)
  • Exomes 𝑓: 0.00058 (3 hom.)
• Consequence: GNAS NM_080425.4 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:3 O:1
• Conservation: PhyloP100: 3.02

Genes affected

GNAS (HGNC:4392): (GNAS complex locus) This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors. [provided by RefSeq, Aug 2012]

ACMG classification

Verdict is Benign. Variant got -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_080425.4.
• BP6: Variant 20-58854492-AGATCCCGACTCCGGGACAGCACCAGCC-A is Benign according to our data. Variant chr20-58854492-AGATCCCGACTCCGGGACAGCACCAGCC-A is described in ClinVar as [Likely_benign]. Clinvar id is 134476.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr20-58854492-AGATCCCGACTCCGGGACAGCACCAGCC-A is described in Lovd as [Benign].
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.00343 (509/148214) while in subpopulation AFR AF= 0.0109 (437/40036). AF 95% confidence interval is 0.0101. There are 4 homozygotes in gnomad4. There are 252 alleles in male gnomad4 subpopulation. Median coverage is 33. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 4 SM,Mitochondrial gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GNAS	NM_016592.5	c.*42+13612_*42+13638delCGACTCCGGGACAGCACCAGCCGATCC		intron_variant	Intron 1 of 12	ENST00000371075.7	NP_057676.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GNAS	ENST00000676826.2	c.1233_1259delCGACTCCGGGACAGCACCAGCCGATCC	p.Asp412_Pro420del	disruptive_inframe_deletion	Exon 1 of 13			ENSP00000504675.2
GNAS	ENST00000371102.8	c.1233_1259delCGACTCCGGGACAGCACCAGCCGATCC	p.Asp412_Pro420del	disruptive_inframe_deletion	Exon 1 of 12	5		ENSP00000360143.4
GNAS	ENST00000371075.7	c.*42+13612_*42+13638delCGACTCCGGGACAGCACCAGCCGATCC		intron_variant	Intron 1 of 12	1	NM_016592.5	ENSP00000360115.3
GNAS	ENST00000663479.2	c.-39+12623_-39+12649delCGACTCCGGGACAGCACCAGCCGATCC		intron_variant	Intron 1 of 12			ENSP00000499353.2
GNAS	ENST00000462499.6	c.-39+12623_-39+12649delCGACTCCGGGACAGCACCAGCCGATCC		intron_variant	Intron 1 of 11	2		ENSP00000499758.2
GNAS	ENST00000467227.6	c.-39+10424_-39+10450delCGACTCCGGGACAGCACCAGCCGATCC		intron_variant	Intron 2 of 12	3		ENSP00000499681.2
GNAS	ENST00000453292.7	c.*42+13612_*42+13638delCGACTCCGGGACAGCACCAGCCGATCC		intron_variant	Intron 1 of 11	5		ENSP00000392000.2

Frequencies

GnomAD3 genomes AF: 0.00346 AC: 512 AN: 148102 Hom.: 4 Cov.: 33

Gnomad AFR AF: 0.0110

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00193

Gnomad ASJ AF: 0.000585

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000864

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.0261

Gnomad NFE AF: 0.000435

Gnomad OTH AF: 0.000980

GnomAD3 exomes AF: 0.000826 AC: 159 AN: 192610 Hom.: 1 AF XY: 0.000732 AC XY: 78 AN XY: 106600

Gnomad AFR exome AF: 0.00726

Gnomad AMR exome AF: 0.00143

Gnomad ASJ exome AF: 0.000552

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000419

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000282

Gnomad OTH exome AF: 0.000984

GnomAD4 exome AF: 0.000578 AC: 827 AN: 1430638 Hom.: 3 AF XY: 0.000532 AC XY: 378 AN XY: 709992

Gnomad4 AFR exome AF: 0.0115

Gnomad4 AMR exome AF: 0.00176

Gnomad4 ASJ exome AF: 0.000233

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000363

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000205

Gnomad4 OTH exome AF: 0.00152

GnomAD4 genome AF: 0.00343 AC: 509 AN: 148214 Hom.: 4 Cov.: 33 AF XY: 0.00348 AC XY: 252 AN XY: 72436

Gnomad4 AFR AF: 0.0109

Gnomad4 AMR AF: 0.00193

Gnomad4 ASJ AF: 0.000585

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00108

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000435

Gnomad4 OTH AF: 0.000971

Alfa AF: 0.00221 Hom.: 0

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:3 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Dec 31, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jul 01, 2024

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

GNAS: PM4, BS1, BS2 -

GNAS-related disorder Benign:1

Jun 13, 2019

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

not specified Other:1

Sep 19, 2013

ITMI

Significance: not provided

Review Status: no classification provided

Collection Method: reference population

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587778382; hg19: chr20-57429547;