rs587778448

Variant names:

• chr12-49051979-TTCAGGTGGCGGGGAAGTGGGCAATTCC-T
• rs587778448
• NM_003482.4:c.1677_1703delGGAATTGCCCACTTCCCCGCCACCTGA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_003482.4(KMT2D):​c.1677_1703delGGAATTGCCCACTTCCCCGCCACCTGA​(p.Glu560_Glu568del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 31)
• Consequence: KMT2D NM_003482.4 disruptive_inframe_deletion
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 3.33
• Publications: 0 publications found

Genes affected

KMT2D (HGNC:7133): (lysine methyltransferase 2D) The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]

KMT2D Gene-Disease associations (from GenCC):

• choanal atresia-athelia-hypothyroidism-delayed puberty-short stature syndrome

  Inheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: Illumina, G2P
• Kabuki syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics, Laboratory for Molecular Medicine, ClinGen
• branchial arch abnormalities, choanal atresia, athelia, hearing loss, and hypothyroidism syndrome

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• Kabuki syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_003482.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003482.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KMT2D	NM_003482.4	MANE Select	c.1677_1703delGGAATTGCCCACTTCCCCGCCACCTGA	p.Glu560_Glu568del	disruptive_inframe_deletion	Exon 11 of 55	NP_003473.3	O14686-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KMT2D	ENST00000301067.12	TSL:5 MANE Select	c.1677_1703delGGAATTGCCCACTTCCCCGCCACCTGA	p.Glu560_Glu568del	disruptive_inframe_deletion	Exon 11 of 55	ENSP00000301067.7	O14686-1
	KMT2D	ENST00000683543.2		c.1677_1703delGGAATTGCCCACTTCCCCGCCACCTGA	p.Glu560_Glu568del	disruptive_inframe_deletion	Exon 11 of 56	ENSP00000506726.1	A0A804HHR9
	KMT2D	ENST00000685166.1		c.1677_1703delGGAATTGCCCACTTCCCCGCCACCTGA	p.Glu560_Glu568del	disruptive_inframe_deletion	Exon 10 of 54	ENSP00000509386.1	O14686-3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: not provided

Revision: no classification provided

Pathogenic	VUS	Benign	Condition
-	-	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.3
Mutation Taster		=144/56	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587778448; hg19: chr12-49445762;