rs587780668
Variant summary
The NM_000077.5(CDKN2A):c.9_32delGGCGGCGGGGAGCAGCATGGAGCC (p.Ala4_Pro11del) variant causes a disruptive inframe deletion change. The variant results in an in-frame change. Note: allele frequency estimates from gnomAD may be inaccurate for this variant type (MNP or indel longer than 3 bp) due to technology limitations. The variant allele was found at a cumulative frequency of 0.0000952 (AC=153) in the gnomAD database across 1,606,464 control chromosomes, including 1 homozygote. The grpmax filtering allele frequency (95% CI) is 0.00153. Variant has been reported in ClinVar as Uncertain Significance (no review stars).
Frequency
Consequence
NM_000077.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- melanoma, cutaneous malignant, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
- melanoma-pancreatic cancer syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
- familial atypical multiple mole melanoma syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- melanoma and neural system tumor syndromeInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
Classification according to ACMG Germline Pathogenicity v2019
Our verdict: Uncertain_significance. The variant received 2 points.
Variant Effect in Transcripts
Automated classification analysis was done for transcript: NM_000077.5. You can select a different transcript below to see updated classification assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDKN2A | MANE Select | c.9_32delGGCGGCGGGGAGCAGCATGGAGCC | p.Ala4_Pro11del | disruptive_inframe_deletion | Exon 1 of 3 | NP_000068.1 | P42771-1 | ||
| CDKN2A | MANE Plus Clinical | c.194-3611_194-3588delGGCGGCGGGGAGCAGCATGGAGCC | intron | N/A | NP_478102.2 | Q8N726-1 | |||
| CDKN2A | c.9_32delGGCGGCGGGGAGCAGCATGGAGCC | p.Ala4_Pro11del | disruptive_inframe_deletion | Exon 1 of 4 | NP_001182061.1 | P42771-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDKN2A | TSL:1 MANE Select | c.9_32delGGCGGCGGGGAGCAGCATGGAGCC | p.Ala4_Pro11del | disruptive_inframe_deletion | Exon 1 of 3 | ENSP00000307101.5 | P42771-1 | ||
| CDKN2A | TSL:1 | c.9_32delGGCGGCGGGGAGCAGCATGGAGCC | p.Ala4_Pro11del | disruptive_inframe_deletion | Exon 1 of 4 | ENSP00000418915.1 | P42771-4 | ||
| CDKN2A | TSL:1 MANE Plus Clinical | c.194-3611_194-3588delGGCGGCGGGGAGCAGCATGGAGCC | intron | N/A | ENSP00000462950.1 | Q8N726-1 |
Frequencies
GnomAD3 genomes AF: 0.000243 AC: 37AN: 151972Hom.: 1 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.000145 AC: 34AN: 233942 AF XY: 0.000132 show subpopulations
GnomAD4 exome AF: 0.0000798 AC: 116AN: 1454492Hom.: 0 AF XY: 0.0000760 AC XY: 55AN XY: 723908 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000243 AC: 37AN: 151972Hom.: 1 Cov.: 32 AF XY: 0.000377 AC XY: 28AN XY: 74232 show subpopulations
Age Distribution
Local populations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.