rs587783634

Variant names:

• chr14-28767471-ACCGCCGCCGCCGCCGCAGCAGCAGCAG-A
• rs587783634
• NM_005249.5:c.209_235delAGCAGCAGCAGCCGCCGCCGCCGCCGC

Your query was ambiguous. Multiple possible variants found:

• chr14-28767471-ACCGCCGCCGCCGCCGCAGCAGCAGCAG-A
• chr14-28767471-ACCGCCGCCGCCGCCGCAGCAGCAGCAG-ACCGCCGCCGCCGCCGCAGCAGCAGCAGCCGCCGCCGCCGCCGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BS2 BA1 BP3

This summary comes from the ClinGen Evidence Repository: The allele frequency of the c.209_235del variant in FOXG1 is 0.17% in Ashkenazi Jewish sub population in gnomAD, which is high enough to be classified as benign based on thresholds defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like conditions BA1). The p.Gln70_Pro78del variant is observed in at least 2 unaffected individuals (GeneDx internal database) (BS2). The p.Gln70_Pro78del variant is an in-frame deletion present in a repetitive region of FOXG1 (BP3). In summary, the p.Gln70_Pro78del variant in FOXG1 is classified as benign based on the ACMG/AMP criteria (BA1, BS2, BP3). LINK:https://erepo.genome.network/evrepo/ui/classification/CA172179/MONDO:0100040/033

• Frequency:
  • Genomes: 𝑓 0.00016 (0 hom., cov: 31)
  • Exomes 𝑓: 0.00013 (0 hom.)
• Consequence: FOXG1 NM_005249.5 disruptive_inframe_deletion
• Clinical Significance: Benign reviewed by expert panel U:1 B:5
• Conservation: PhyloP100: 2.38
• Publications: 1 publications found

Genes affected

FOXG1 (HGNC:3811): (forkhead box G1) This locus encodes a member of the fork-head transcription factor family. The encoded protein, which functions as a transcriptional repressor, is highly expressed in neural tissues during brain development. Mutations at this locus have been associated with Rett syndrome and a diverse spectrum of neurodevelopmental disorders defined as part of the FOXG1 syndrome. This gene is disregulated in many types of cancer and is the target of multiple microRNAs that regulate the proliferation of tumor cells. [provided by RefSeq, Jul 2020]

LINC01551 (HGNC:19828): (long intergenic non-protein coding RNA 1551)

ACMG classification

Our verdict: Benign. The variant received -13 ACMG points.

• BP3: For more information check the summary or visit ClinGen Evidence Repository.
• BS2: For more information check the summary or visit ClinGen Evidence Repository.
• BA1: For more information check the summary or visit ClinGen Evidence Repository.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005249.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FOXG1	NM_005249.5	MANE Select	c.209_235delAGCAGCAGCAGCCGCCGCCGCCGCCGC	p.Gln70_Pro78del	disruptive_inframe_deletion	Exon 1 of 1	NP_005240.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FOXG1	ENST00000313071.7	TSL:6 MANE Select	c.209_235delAGCAGCAGCAGCCGCCGCCGCCGCCGC	p.Gln70_Pro78del	disruptive_inframe_deletion	Exon 1 of 1	ENSP00000339004.3	P55316
	FOXG1	ENST00000706482.1		c.209_235delAGCAGCAGCAGCCGCCGCCGCCGCCGC	p.Gln70_Pro78del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000516406.1	P55316
	LINC01551	ENST00000675861.1		n.374+1475_374+1501delAGCAGCAGCAGCCGCCGCCGCCGCCGC		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.000163 AC: 21 AN: 128906 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000576

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000758

Gnomad ASJ AF: 0.00130

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000143

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000200

Gnomad OTH AF: 0.000565

GnomAD2 exomes AF: 0.000257 AC: 19 AN: 73900 AF XY: 0.000258

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000299

Gnomad ASJ exome AF: 0.00157

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000109

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000132 AC: 127 AN: 962086 Hom.: 0 AF XY: 0.000135 AC XY: 63 AN XY: 467330

African (AFR) AF: 0.000256 AC: 5 AN: 19562

American (AMR) AF: 0.000213 AC: 4 AN: 18808

Ashkenazi Jewish (ASJ) AF: 0.00142 AC: 19 AN: 13408

East Asian (EAS) AF: 0.00 AC: 0 AN: 13832

South Asian (SAS) AF: 0.0000522 AC: 2 AN: 38326

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 17056

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2352

European-Non Finnish (NFE) AF: 0.000118 AC: 95 AN: 804284

Other (OTH) AF: 0.0000580 AC: 2 AN: 34458

GnomAD4 genome AF: 0.000163 AC: 21 AN: 128988 Hom.: 0 Cov.: 31 AF XY: 0.0000955 AC XY: 6 AN XY: 62816

African (AFR) AF: 0.0000574 AC: 2 AN: 34822

American (AMR) AF: 0.0000757 AC: 1 AN: 13208

Ashkenazi Jewish (ASJ) AF: 0.00130 AC: 4 AN: 3086

East Asian (EAS) AF: 0.00 AC: 0 AN: 4266

South Asian (SAS) AF: 0.00 AC: 0 AN: 3954

European-Finnish (FIN) AF: 0.000143 AC: 1 AN: 6996

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 180

European-Non Finnish (NFE) AF: 0.000200 AC: 12 AN: 59870

Other (OTH) AF: 0.000559 AC: 1 AN: 1788

Alfa AF: 0.0000612 Hom.: 0

ClinVar

ClinVar submissions

Significance: Benign

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
-	1	1	Rett syndrome, congenital variant (2)
-	-	1	FOXG1 disorder (1)
-	-	1	Inborn genetic diseases (1)
-	-	1	not provided (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.4
Mutation Taster		=153/47	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587783634; hg19: chr14-29236677;