rs587783634

Positions:

• chr14-28767471-ACCGCCGCCGCCGCCGCAGCAGCAGCAG-A
• chr14-28767471-ACCGCCGCCGCCGCCGCAGCAGCAGCAG-ACCGCCGCCGCCGCCGCAGCAGCAGCAGCCGCCGCCGCCGCCGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. Variant got -13 ACMG points: 0P and 13B. BS2 BA1 BP3

This summary comes from the ClinGen Evidence Repository: The allele frequency of the c.209_235del variant in FOXG1 is 0.17% in Ashkenazi Jewish sub population in gnomAD, which is high enough to be classified as benign based on thresholds defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like conditions BA1). The p.Gln70_Pro78del variant is observed in at least 2 unaffected individuals (GeneDx internal database) (BS2). The p.Gln70_Pro78del variant is an in-frame deletion present in a repetitive region of FOXG1 (BP3). In summary, the p.Gln70_Pro78del variant in FOXG1 is classified as benign based on the ACMG/AMP criteria (BA1, BS2, BP3). LINK:https://erepo.genome.network/evrepo/ui/classification/CA172179/MONDO:0100040/033

• Frequency:
  • Genomes: 𝑓 0.00016 (0 hom., cov: 31)
  • Exomes 𝑓: 0.00013 (0 hom.)
• Consequence: FOXG1 NM_005249.5 disruptive_inframe_deletion
• Clinical Significance: Benign reviewed by expert panel U:1 B:5
• Conservation: PhyloP100: 2.38

Genes affected

FOXG1 (HGNC:3811): (forkhead box G1) This locus encodes a member of the fork-head transcription factor family. The encoded protein, which functions as a transcriptional repressor, is highly expressed in neural tissues during brain development. Mutations at this locus have been associated with Rett syndrome and a diverse spectrum of neurodevelopmental disorders defined as part of the FOXG1 syndrome. This gene is disregulated in many types of cancer and is the target of multiple microRNAs that regulate the proliferation of tumor cells. [provided by RefSeq, Jul 2020]

LINC01551 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -13 ACMG points.

• BP3: For more information check the summary or visit ClinGen Evidence Repository.
• BS2: For more information check the summary or visit ClinGen Evidence Repository.
• BA1: For more information check the summary or visit ClinGen Evidence Repository.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FOXG1	NM_005249.5	c.209_235delAGCAGCAGCAGCCGCCGCCGCCGCCGC	p.Gln70_Pro78del	disruptive_inframe_deletion	1/1	ENST00000313071.7	NP_005240.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FOXG1	ENST00000313071.7	c.209_235delAGCAGCAGCAGCCGCCGCCGCCGCCGC	p.Gln70_Pro78del	disruptive_inframe_deletion	1/1	6	NM_005249.5	ENSP00000339004.3
FOXG1	ENST00000706482.1	c.209_235delAGCAGCAGCAGCCGCCGCCGCCGCCGC	p.Gln70_Pro78del	disruptive_inframe_deletion	2/2			ENSP00000516406.1
LINC01551	ENST00000675861.1	n.374+1475_374+1501delAGCAGCAGCAGCCGCCGCCGCCGCCGC		intron_variant

Frequencies

GnomAD3 genomes AF: 0.000163 AC: 21 AN: 128906 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000576

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000758

Gnomad ASJ AF: 0.00130

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000143

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000200

Gnomad OTH AF: 0.000565

GnomAD3 exomes AF: 0.000257 AC: 19 AN: 73900 Hom.: 0 AF XY: 0.000258 AC XY: 11 AN XY: 42564

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000299

Gnomad ASJ exome AF: 0.00157

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000126

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000109

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000132 AC: 127 AN: 962086 Hom.: 0 AF XY: 0.000135 AC XY: 63 AN XY: 467330

Gnomad4 AFR exome AF: 0.000256

Gnomad4 AMR exome AF: 0.000213

Gnomad4 ASJ exome AF: 0.00142

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000522

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000118

Gnomad4 OTH exome AF: 0.0000580

GnomAD4 genome AF: 0.000163 AC: 21 AN: 128988 Hom.: 0 Cov.: 31 AF XY: 0.0000955 AC XY: 6 AN XY: 62816

Gnomad4 AFR AF: 0.0000574

Gnomad4 AMR AF: 0.0000757

Gnomad4 ASJ AF: 0.00130

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000143

Gnomad4 NFE AF: 0.000200

Gnomad4 OTH AF: 0.000559

Alfa AF: 0.0000612 Hom.: 0

ClinVar

Significance: Benign

Submissions summary: Uncertain:1 Benign:5

Revision: reviewed by expert panel

Submissions by phenotype

Rett syndrome, congenital variant Uncertain:1 Benign:1

Likely benign, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Dec 25, 2023	- -
Uncertain significance, criteria provided, single submitter	clinical testing	Genetic Services Laboratory, University of Chicago	Mar 06, 2014	- -

not specified Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Eurofins Ntd Llc (ga)

Jun 21, 2017

- -

Inborn genetic diseases Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Ambry Genetics

Mar 17, 2017

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

not provided Benign:1

Likely benign, criteria provided, single submitter

clinical testing

GeneDx

Feb 05, 2020

- -

FOXG1 disorder Benign:1

Benign, reviewed by expert panel

curation

ClinGen Rett and Angelman-like Disorders Variant Curation Expert Panel

Apr 14, 2023

The allele frequency of the c.209_235del variant in FOXG1 is 0.17% in Ashkenazi Jewish sub population in gnomAD, which is high enough to be classified as benign based on thresholds defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like conditions BA1). The p.Gln70_Pro78del variant is observed in at least 2 unaffected individuals (GeneDx internal database) (BS2). The p.Gln70_Pro78del variant is an in-frame deletion present in a repetitive region of FOXG1 (BP3). In summary, the p.Gln70_Pro78del variant in FOXG1 is classified as benign based on the ACMG/AMP criteria (BA1, BS2, BP3). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587783634; hg19: chr14-29236677;