rs63751076

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000518.5(HBB):​c.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT​(p.Gly26fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

HBB
NM_000518.5 frameshift, splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:3

Conservation

PhyloP100: 0.304
Variant links:
Genes affected
HBB (HGNC:4827): (hemoglobin subunit beta) The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 141 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 11-5226902-AAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC-A is Pathogenic according to our data. Variant chr11-5226902-AAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 15445.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr11-5226902-AAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC-A is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
HBBNM_000518.5 linkuse as main transcriptc.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT p.Gly26fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant 1/3 ENST00000335295.4 NP_000509.1 P68871D9YZU5

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
HBBENST00000335295.4 linkuse as main transcriptc.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT p.Gly26fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant 1/31 NM_000518.5 ENSP00000333994.3 P68871

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Beta zero thalassemia Pathogenic:1
Pathogenic, no assertion criteria providedliterature onlyOMIMMar 01, 1984- -
Hemoglobinopathy Pathogenic:1
Likely pathogenic, criteria provided, single submitterclinical testingWomen's Health and Genetics/Laboratory Corporation of America, LabCorpJun 05, 2023Variant summary: HBB c.76_92+27del44 is located in a canonical splice-site and is predicted to affect mRNA splicing resulting in a significantly altered protein due to either exon skipping, shortening, or inclusion of intronic material, in addition to removing part of the coding sequence of exon 1. Several computational tools predict a significant impact on normal splicing: Three predict the variant abolishes a canonical 5' splicing donor site. However, these predictions have yet to be confirmed by functional studies. The variant was absent in 251226 control chromosomes (gnomAD). c.76_92+27del44 has been reported in the literature in an individual affected with Beta Thalassemia who was compound heterozygous with another likely pathogenic variant (Gonzalez-Redondo_1989). These data suggest the variant may be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publication has been ascertained in the context of this evaluation (PMID: 2753736). One submitter has provided a clinical-significance assessment for this variant to ClinVar after 2014, and classified it as pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic. -
beta Thalassemia Pathogenic:1
Pathogenic, no assertion criteria providedcurationThe ITHANET community portal, The Cyprus Institute of Neurology and GeneticsNov 25, 2019- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs63751076; hg19: chr11-5248132; API