rs63751076
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000518.5(HBB):c.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT(p.Gly26fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Genomes: not found (cov: 32)
Consequence
HBB
NM_000518.5 frameshift, splice_donor, splice_region, intron
NM_000518.5 frameshift, splice_donor, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.304
Genes affected
HBB (HGNC:4827): (hemoglobin subunit beta) The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 141 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 11-5226902-AAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC-A is Pathogenic according to our data. Variant chr11-5226902-AAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 15445.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr11-5226902-AAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC-A is described in Lovd as [Pathogenic].
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
HBB | NM_000518.5 | c.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT | p.Gly26fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | 1/3 | ENST00000335295.4 | NP_000509.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
HBB | ENST00000335295.4 | c.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT | p.Gly26fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | 1/3 | 1 | NM_000518.5 | ENSP00000333994.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Likely pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Beta zero thalassemia Pathogenic:1
Pathogenic, no assertion criteria provided | literature only | OMIM | Mar 01, 1984 | - - |
Hemoglobinopathy Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Women's Health and Genetics/Laboratory Corporation of America, LabCorp | Jun 05, 2023 | Variant summary: HBB c.76_92+27del44 is located in a canonical splice-site and is predicted to affect mRNA splicing resulting in a significantly altered protein due to either exon skipping, shortening, or inclusion of intronic material, in addition to removing part of the coding sequence of exon 1. Several computational tools predict a significant impact on normal splicing: Three predict the variant abolishes a canonical 5' splicing donor site. However, these predictions have yet to be confirmed by functional studies. The variant was absent in 251226 control chromosomes (gnomAD). c.76_92+27del44 has been reported in the literature in an individual affected with Beta Thalassemia who was compound heterozygous with another likely pathogenic variant (Gonzalez-Redondo_1989). These data suggest the variant may be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publication has been ascertained in the context of this evaluation (PMID: 2753736). One submitter has provided a clinical-significance assessment for this variant to ClinVar after 2014, and classified it as pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic. - |
beta Thalassemia Pathogenic:1
Pathogenic, no assertion criteria provided | curation | The ITHANET community portal, The Cyprus Institute of Neurology and Genetics | Nov 25, 2019 | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at