rs71391718
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The ENST00000677997.1(MTHFD2):c.24-7398_24-7374delCTTGTGTTGTCCGGCCTTCGGTGACinsTTTCTCTTGTGTTG variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000677997.1 intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000677997.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
There are no transcript annotations for this variant. | |||||||||
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MTHFD2 | c.24-7398_24-7374delCTTGTGTTGTCCGGCCTTCGGTGACinsTTTCTCTTGTGTTG | intron | N/A | ENSP00000503074.1 | A0A7I2V2U6 | ||||
| MTHFD2 | c.-303-3075_-303-3051delCTTGTGTTGTCCGGCCTTCGGTGACinsTTTCTCTTGTGTTG | intron | N/A | ENSP00000503486.1 | P13995-2 | ||||
| MTHFD2 | c.-205-7398_-205-7374delCTTGTGTTGTCCGGCCTTCGGTGACinsTTTCTCTTGTGTTG | intron | N/A | ENSP00000504687.1 | P13995-2 |
Frequencies
GnomAD3 genomes Cov.: 0
GnomAD4 genome Cov.: 0
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at