rs71391718

Variant names:

• chr2-74198307-CTTGTGTTGTCCGGCCTTCGGTGAC-TTTCTCTTGTGTTG
• rs71391718
• ENST00000624835.2:n.230_254delGTCACCGAAGGCCGGACAACACAAGinsCAACACAAGAGAAA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000624835.2(ENSG00000279070):​n.230_254delGTCACCGAAGGCCGGACAACACAAGinsCAACACAAGAGAAA variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 0)
• Consequence: ENSG00000279070 ENST00000624835.2 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.550
• Publications: 1 publications found

Genes affected

ENSG00000279070 (HGNC:):

MTHFD2 (HGNC:7434): (methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase) This gene encodes a nuclear-encoded mitochondrial bifunctional enzyme with methylenetetrahydrofolate dehydrogenase and methenyltetrahydrofolate cyclohydrolase activities. The enzyme functions as a homodimer and is unique in its absolute requirement for magnesium and inorganic phosphate. Formation of the enzyme-magnesium complex allows binding of NAD. Alternative splicing results in two different transcripts, one protein-coding and the other not protein-coding. This gene has a pseudogene on chromosome 7. [provided by RefSeq, Mar 2009]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ENSG00000279070	ENST00000624835.2	n.230_254delGTCACCGAAGGCCGGACAACACAAGinsCAACACAAGAGAAA		non_coding_transcript_exon_variant	Exon 1 of 1	6
MTHFD2	ENST00000677997.1	c.24-7398_24-7374delCTTGTGTTGTCCGGCCTTCGGTGACinsTTTCTCTTGTGTTG		intron_variant	Intron 1 of 7			ENSP00000503074.1
MTHFD2	ENST00000677170.1	c.-303-3075_-303-3051delCTTGTGTTGTCCGGCCTTCGGTGACinsTTTCTCTTGTGTTG		intron_variant	Intron 2 of 9			ENSP00000503486.1
MTHFD2	ENST00000678684.1	c.-205-7398_-205-7374delCTTGTGTTGTCCGGCCTTCGGTGACinsTTTCTCTTGTGTTG		intron_variant	Intron 1 of 7			ENSP00000504687.1

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.55

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71391718; hg19: chr2-74425434;