rs727502780

Variant names:

• chr16-72788110-TGCTGCTGCTGCTGCTGTAGTTGCC-T
• rs727502780
• NM_006885.4:c.10142_10165delGGCAACTACAGCAGCAGCAGCAGC

Your query was ambiguous. Multiple possible variants found:

• chr16-72788110-TGCTGCTGCTGCTGCTGTAGTTGCC-T
• chr16-72788110-TGCTGCTGCTGCTGCTGTAGTTGCC-TGCTGCTGCTGCTGCTGTAGTTGCCGCTGCTGCTGCTGCTGTAGTTGCC

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP3 BP6 BS1 BS2

The NM_006885.4(ZFHX3):​c.10142_10165delGGCAACTACAGCAGCAGCAGCAGC​(p.Arg3381_Gln3388del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000444 in 1,599,342 control chromosomes in the GnomAD database, including 3 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00036 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00045 (3 hom.)
• Consequence: ZFHX3 NM_006885.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1 B:1
• Conservation: PhyloP100: 7.12
• Publications: 3 publications found

Genes affected

ZFHX3 (HGNC:777): (zinc finger homeobox 3) This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

ZFHX3-AS1 (HGNC:56033): (ZFHX3 antisense RNA 1)

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_006885.4
• BP6: Variant 16-72788110-TGCTGCTGCTGCTGCTGTAGTTGCC-T is Benign according to our data. Variant chr16-72788110-TGCTGCTGCTGCTGCTGTAGTTGCC-T is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 18167.
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.000363 (55/151470) while in subpopulation SAS AF = 0.00229 (11/4794). AF 95% confidence interval is 0.00129. There are 0 homozygotes in GnomAd4. There are 26 alleles in the male GnomAd4 subpopulation. Median coverage is 32. This position passed quality control check.
• BS2: High Homozygotes in GnomAdExome4 at 3 AD,AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006885.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZFHX3	NM_006885.4	MANE Select	c.10142_10165delGGCAACTACAGCAGCAGCAGCAGC	p.Arg3381_Gln3388del	disruptive_inframe_deletion	Exon 10 of 10	NP_008816.3
	ZFHX3	NM_001386735.1		c.10142_10165delGGCAACTACAGCAGCAGCAGCAGC	p.Arg3381_Gln3388del	disruptive_inframe_deletion	Exon 17 of 17	NP_001373664.1	Q15911-1
	ZFHX3	NM_001164766.2		c.7400_7423delGGCAACTACAGCAGCAGCAGCAGC	p.Arg2467_Gln2474del	disruptive_inframe_deletion	Exon 9 of 9	NP_001158238.1	Q15911-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZFHX3	ENST00000268489.10	TSL:1 MANE Select	c.10142_10165delGGCAACTACAGCAGCAGCAGCAGC	p.Arg3381_Gln3388del	disruptive_inframe_deletion	Exon 10 of 10	ENSP00000268489.5	Q15911-1
	ZFHX3	ENST00000397992.5	TSL:1	c.7400_7423delGGCAACTACAGCAGCAGCAGCAGC	p.Arg2467_Gln2474del	disruptive_inframe_deletion	Exon 9 of 9	ENSP00000438926.3	Q15911-2
	ZFHX3	ENST00000641206.2		c.10142_10165delGGCAACTACAGCAGCAGCAGCAGC	p.Arg3381_Gln3388del	disruptive_inframe_deletion	Exon 18 of 18	ENSP00000493252.1	Q15911-1

Frequencies

GnomAD3 genomes AF: 0.000363 AC: 55 AN: 151352 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000146

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000330

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000389

Gnomad SAS AF: 0.00229

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00955

Gnomad NFE AF: 0.000399

Gnomad OTH AF: 0.000481

GnomAD2 exomes AF: 0.000558 AC: 134 AN: 240058 AF XY: 0.000668

Gnomad AFR exome AF: 0.0000657

Gnomad AMR exome AF: 0.000206

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000499

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000462

Gnomad OTH exome AF: 0.000846

GnomAD4 exome AF: 0.000452 AC: 655 AN: 1447872 Hom.: 3 AF XY: 0.000520 AC XY: 374 AN XY: 719724

African (AFR) AF: 0.000180 AC: 6 AN: 33248

American (AMR) AF: 0.000250 AC: 11 AN: 43990

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25822

East Asian (EAS) AF: 0.00109 AC: 43 AN: 39476

South Asian (SAS) AF: 0.00243 AC: 206 AN: 84906

European-Finnish (FIN) AF: 0.0000199 AC: 1 AN: 50270

Middle Eastern (MID) AF: 0.00210 AC: 12 AN: 5716

European-Non Finnish (NFE) AF: 0.000305 AC: 337 AN: 1104522

Other (OTH) AF: 0.000651 AC: 39 AN: 59922

GnomAD4 genome AF: 0.000363 AC: 55 AN: 151470 Hom.: 0 Cov.: 32 AF XY: 0.000351 AC XY: 26 AN XY: 74080

African (AFR) AF: 0.000145 AC: 6 AN: 41346

American (AMR) AF: 0.000329 AC: 5 AN: 15192

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3462

East Asian (EAS) AF: 0.000390 AC: 2 AN: 5132

South Asian (SAS) AF: 0.00229 AC: 11 AN: 4794

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10576

Middle Eastern (MID) AF: 0.0103 AC: 3 AN: 292

European-Non Finnish (NFE) AF: 0.000399 AC: 27 AN: 67662

Other (OTH) AF: 0.000476 AC: 1 AN: 2102

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.000287

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)
-	-	1	not specified (1)
1	-	-	Prostate cancer, somatic (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.1
Mutation Taster		=72/128	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs727502780; hg19: chr16-72822009;