rs727502780

Positions:

• chr16-72788110-TGCTGCTGCTGCTGCTGTAGTTGCC-T
• chr16-72788110-TGCTGCTGCTGCTGCTGTAGTTGCC-TGCTGCTGCTGCTGCTGTAGTTGCCGCTGCTGCTGCTGCTGTAGTTGCC

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP3 BP6 BS2

The NM_006885.4(ZFHX3):​c.10142_10165delGGCAACTACAGCAGCAGCAGCAGC​(p.Arg3381_Gln3388del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000444 in 1,599,342 control chromosomes in the GnomAD database, including 3 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00036 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00045 (3 hom.)
• Consequence: ZFHX3 NM_006885.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1 B:1
• Conservation: PhyloP100: 7.12

Genes affected

ZFHX3 (HGNC:777): (zinc finger homeobox 3) This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

ZFHX3-AS1 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_006885.4
• BP6: Variant 16-72788110-TGCTGCTGCTGCTGCTGTAGTTGCC-T is Benign according to our data. Variant chr16-72788110-TGCTGCTGCTGCTGCTGTAGTTGCC-T is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 18167.We mark this variant Likely_benign, oryginal submissions are: {Uncertain_significance=1, Benign=1}.
• BS2: High AC in GnomAd4 at 55 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ZFHX3	NM_006885.4	c.10142_10165delGGCAACTACAGCAGCAGCAGCAGC	p.Arg3381_Gln3388del	disruptive_inframe_deletion	10/10	ENST00000268489.10	NP_008816.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ZFHX3	ENST00000268489.10	c.10142_10165delGGCAACTACAGCAGCAGCAGCAGC	p.Arg3381_Gln3388del	disruptive_inframe_deletion	10/10	1	NM_006885.4	ENSP00000268489.5

Frequencies

GnomAD3 genomes AF: 0.000363 AC: 55 AN: 151352 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000146

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000330

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000389

Gnomad SAS AF: 0.00229

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00955

Gnomad NFE AF: 0.000399

Gnomad OTH AF: 0.000481

GnomAD3 exomes AF: 0.000558 AC: 134 AN: 240058 Hom.: 0 AF XY: 0.000668 AC XY: 87 AN XY: 130176

Gnomad AFR exome AF: 0.0000657

Gnomad AMR exome AF: 0.000206

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000499

Gnomad SAS exome AF: 0.00208

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000462

Gnomad OTH exome AF: 0.000846

GnomAD4 exome AF: 0.000452 AC: 655 AN: 1447872 Hom.: 3 AF XY: 0.000520 AC XY: 374 AN XY: 719724

Gnomad4 AFR exome AF: 0.000180

Gnomad4 AMR exome AF: 0.000250

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00109

Gnomad4 SAS exome AF: 0.00243

Gnomad4 FIN exome AF: 0.0000199

Gnomad4 NFE exome AF: 0.000305

Gnomad4 OTH exome AF: 0.000651

GnomAD4 genome AF: 0.000363 AC: 55 AN: 151470 Hom.: 0 Cov.: 32 AF XY: 0.000351 AC XY: 26 AN XY: 74080

Gnomad4 AFR AF: 0.000145

Gnomad4 AMR AF: 0.000329

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000390

Gnomad4 SAS AF: 0.00229

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000399

Gnomad4 OTH AF: 0.000476

Bravo AF: 0.000287

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:1 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Prostate cancer, somatic Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Apr 01, 2005

- -

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

CeGaT Center for Human Genetics Tuebingen

Feb 01, 2017

- -

not specified Benign:1

Benign, criteria provided, single submitter

clinical testing

Mendelics

May 04, 2022

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs727502780; hg19: chr16-72822009;