rs727503992

Variant names:

• chr6-129315539-ACCAAGGGCATTGTTTTTCAACAT-A
• rs727503992
• NM_000426.4:c.3623_3645delAGGGCATTGTTTTTCAACATCCA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000426.4(LAMA2):​c.3623_3645delAGGGCATTGTTTTTCAACATCCA​(p.Lys1208ArgfsTer27) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000124 in 1,614,104 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: LAMA2 NM_000426.4 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 9.51
• Publications: 0 publications found

Genes affected

LAMA2 (HGNC:6482): (laminin subunit alpha 2) Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]

LAMA2 Gene-Disease associations (from GenCC):

• congenital merosin-deficient muscular dystrophy 1A

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, G2P, Myriad Women’s Health
• LAMA2-related muscular dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• muscular dystrophy, limb-girdle, autosomal recessive 23

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 6-129315539-ACCAAGGGCATTGTTTTTCAACAT-A is Pathogenic according to our data. Variant chr6-129315539-ACCAAGGGCATTGTTTTTCAACAT-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 167242.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000426.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LAMA2	NM_000426.4	MANE Select	c.3623_3645delAGGGCATTGTTTTTCAACATCCA	p.Lys1208ArgfsTer27	frameshift	Exon 25 of 65	NP_000417.3
	LAMA2	NM_001079823.2		c.3623_3645delAGGGCATTGTTTTTCAACATCCA	p.Lys1208ArgfsTer27	frameshift	Exon 25 of 64	NP_001073291.2	A0A087WYF1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LAMA2	ENST00000421865.3	TSL:5 MANE Select	c.3623_3645delAGGGCATTGTTTTTCAACATCCA	p.Lys1208ArgfsTer27	frameshift	Exon 25 of 65	ENSP00000400365.2	P24043
	LAMA2	ENST00000618192.5	TSL:5	c.3887_3909delAGGGCATTGTTTTTCAACATCCA	p.Lys1296ArgfsTer27	frameshift	Exon 26 of 66	ENSP00000480802.2	A0A087WX80
	LAMA2	ENST00000617695.5	TSL:5	c.3623_3645delAGGGCATTGTTTTTCAACATCCA	p.Lys1208ArgfsTer27	frameshift	Exon 25 of 64	ENSP00000481744.2	A0A087WYF1

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152222 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251470 AF XY: 0.00000736

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000879

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461882 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727246

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 8.99e-7 AC: 1 AN: 1112004

Other (OTH) AF: 0.00 AC: 0 AN: 60396

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152222 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74376

African (AFR) AF: 0.00 AC: 0 AN: 41458

American (AMR) AF: 0.00 AC: 0 AN: 15282

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5198

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10626

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68038

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Merosin deficient congenital muscular dystrophy (2)
2	-	-	not provided (2)
1	-	-	LAMA2-related muscular dystrophy (1)
1	-	-	Merosin deficient congenital muscular dystrophy;C4748327:Muscular dystrophy, limb-girdle, autosomal recessive 23 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs727503992; hg19: chr6-129636684;