rs730880277

Variant names:

• chr11-22625558-CCTGGAAGTTCGCTAATCCCGGAA-C
• rs730880277
• NM_022725.4:c.230_252delTTCCGGGATTAGCGAACTTCCAG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_022725.4(FANCF):​c.230_252delTTCCGGGATTAGCGAACTTCCAG​(p.Val77GlyfsTer6) variant causes a frameshift change. The variant allele was found at a frequency of 0.00000558 in 1,613,946 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. V77V) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000048 (0 hom.)
• Consequence: FANCF NM_022725.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 3.80
• Publications: 1 publications found

Genes affected

FANCF (HGNC:3587): (FA complementation group F) The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group F. [provided by RefSeq, Jul 2008]

GAS2 (HGNC:4167): (growth arrest specific 2) The protein encoded by this gene is a caspase-3 substrate that plays a role in regulating microfilament and cell shape changes during apoptosis. It can also modulate cell susceptibility to p53-dependent apoptosis by inhibiting calpain activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2017]

GAS2 Gene-Disease associations (from GenCC):

• hearing loss disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• hearing loss, autosomal recessive 125

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 40 pathogenic variants in the truncated region.
• PP5: Variant 11-22625558-CCTGGAAGTTCGCTAATCCCGGAA-C is Pathogenic according to our data. Variant chr11-22625558-CCTGGAAGTTCGCTAATCCCGGAA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 6340.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FANCF	NM_022725.4	c.230_252delTTCCGGGATTAGCGAACTTCCAG	p.Val77GlyfsTer6	frameshift_variant	Exon 1 of 1	ENST00000327470.6	NP_073562.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FANCF	ENST00000327470.6	c.230_252delTTCCGGGATTAGCGAACTTCCAG	p.Val77GlyfsTer6	frameshift_variant	Exon 1 of 1	6	NM_022725.4	ENSP00000330875.3
GAS2	ENST00000648096.1	n.56_78delAGTTCGCTAATCCCGGAACTGGA		non_coding_transcript_exon_variant	Exon 1 of 1
GAS2	ENST00000528582.5	c.-275_-253delCTGGAAGTTCGCTAATCCCGGAA		upstream_gene_variant		3		ENSP00000432584.1

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152232 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000482

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000798 AC: 2 AN: 250516 AF XY: 0.00000737

Gnomad AFR exome AF: 0.000124

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000479 AC: 7 AN: 1461714 Hom.: 0 AF XY: 0.00000413 AC XY: 3 AN XY: 727168

African (AFR) AF: 0.000149 AC: 5 AN: 33478

American (AMR) AF: 0.0000447 AC: 2 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53270

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111994

Other (OTH) AF: 0.00 AC: 0 AN: 60392

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152232 Hom.: 0 Cov.: 33 AF XY: 0.0000134 AC XY: 1 AN XY: 74376

African (AFR) AF: 0.0000482 AC: 2 AN: 41466

American (AMR) AF: 0.00 AC: 0 AN: 15286

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3464

East Asian (EAS) AF: 0.00 AC: 0 AN: 5194

South Asian (SAS) AF: 0.00 AC: 0 AN: 4836

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10628

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68036

Other (OTH) AF: 0.00 AC: 0 AN: 2094

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000113

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Fanconi anemia complementation group F Pathogenic:3

Feb 06, 2024

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jan 01, 2000

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Jun 19, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Fanconi anemia Pathogenic:1

Jul 07, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Val77Glyfs*6) in the FANCF gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 298 amino acid(s) of the FANCF protein. This variant is present in population databases (rs730880277, gnomAD 0.01%). This premature translational stop signal has been observed in individual(s) with Fanconi-anemia (PMID: 10615118). This variant is also known as 23 bp nt. 230-252. ClinVar contains an entry for this variant (Variation ID: 6340). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this premature translational stop signal affects FANCF function (PMID: 10615118). This variant disrupts a region of the FANCF protein in which other variant(s) (Leu162Aspfs*103) have been determined to be pathogenic (PMID: 10615118, 26033879, 27714961, 28102861). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.8
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs730880277; hg19: chr11-22647104;