rs730881840

Variant names:

• chr8-89982757-CATGATTTCGGCTGATCGACTGATCATTTTCA-C
• rs730881840
• NM_002485.5:c.105_135delTGAAAATGATCAGTCGATCAGCCGAAATCAT

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_002485.5(NBN):​c.105_135delTGAAAATGATCAGTCGATCAGCCGAAATCAT​(p.Ile35MetfsTer4) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. I35I) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: NBN NM_002485.5 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:7 U:1
• Conservation: PhyloP100: 7.14
• Publications: 0 publications found

Genes affected

NBN (HGNC:7652): (nibrin) Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]

NBN Gene-Disease associations (from GenCC):

• Nijmegen breakage syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Myriad Women’s Health, G2P, Orphanet, ClinGen
• rhabdomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• idiopathic aplastic anemia

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• prostate cancer

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-89982757-CATGATTTCGGCTGATCGACTGATCATTTTCA-C is Pathogenic according to our data. Variant chr8-89982757-CATGATTTCGGCTGATCGACTGATCATTTTCA-C is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 182703.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002485.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NBN	NM_002485.5	MANE Select	c.105_135delTGAAAATGATCAGTCGATCAGCCGAAATCAT	p.Ile35MetfsTer4	frameshift	Exon 2 of 16	NP_002476.2
	NBN	NM_001024688.3		c.-192_-162delTGAAAATGATCAGTCGATCAGCCGAAATCAT		5_prime_UTR	Exon 2 of 17	NP_001019859.1	A0A0C4DG07
	NBN	NM_001440379.1		c.-142_-112delTGAAAATGATCAGTCGATCAGCCGAAATCAT		5_prime_UTR	Exon 2 of 16	NP_001427308.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NBN	ENST00000265433.8	TSL:1 MANE Select	c.105_135delTGAAAATGATCAGTCGATCAGCCGAAATCAT	p.Ile35MetfsTer4	frameshift	Exon 2 of 16	ENSP00000265433.4	O60934
	NBN	ENST00000697309.1		c.105_135delTGAAAATGATCAGTCGATCAGCCGAAATCAT	p.Ile35MetfsTer4	frameshift	Exon 2 of 15	ENSP00000513244.1	A0A8V8TKY5
	NBN	ENST00000697293.1		c.105_135delTGAAAATGATCAGTCGATCAGCCGAAATCAT	p.Ile35MetfsTer4	frameshift	Exon 2 of 17	ENSP00000513230.1	A0A8V8TM80

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.00 AC: 0 AN: 251424 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
4	-	-	Microcephaly, normal intelligence and immunodeficiency (4)
1	1	-	not provided (2)
1	-	-	Aplastic anemia (1)
1	-	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.1
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs730881840; hg19: chr8-90994985;