rs730881840

Variant names:

• chr8-89982757-CATGATTTCGGCTGATCGACTGATCATTTTCA-C
• rs730881840
• NM_002485.5:c.105_135delTGAAAATGATCAGTCGATCAGCCGAAATCAT

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_002485.5(NBN):​c.105_135delTGAAAATGATCAGTCGATCAGCCGAAATCAT​(p.Ile35MetfsTer4) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: NBN NM_002485.5 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:7 U:1
• Conservation: PhyloP100: 7.14

Genes affected

NBN (HGNC:7652): (nibrin) Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 8-89982757-CATGATTTCGGCTGATCGACTGATCATTTTCA-C is Pathogenic according to our data. Variant chr8-89982757-CATGATTTCGGCTGATCGACTGATCATTTTCA-C is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 182703.We mark this variant Likely_pathogenic, oryginal submissions are: {Likely_pathogenic=2, Uncertain_significance=1, Pathogenic=5}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NBN	NM_002485.5	c.105_135delTGAAAATGATCAGTCGATCAGCCGAAATCAT	p.Ile35MetfsTer4	frameshift_variant	Exon 2 of 16	ENST00000265433.8	NP_002476.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NBN	ENST00000265433.8	c.105_135delTGAAAATGATCAGTCGATCAGCCGAAATCAT	p.Ile35MetfsTer4	frameshift_variant	Exon 2 of 16	1	NM_002485.5	ENSP00000265433.4

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:7 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Microcephaly, normal intelligence and immunodeficiency Pathogenic:4

Nov 09, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Ile35Metfs*4) in the NBN gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in NBN are known to be pathogenic (PMID: 9590180, 16415040). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with NBN-related conditions. ClinVar contains an entry for this variant (Variation ID: 182703). For these reasons, this variant has been classified as Pathogenic. -

Dec 16, 2016

Counsyl

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Oct 25, 2024

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: NBN c.105_135del31 (p.Ile35MetfsX4) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The frequency data for this variant in gnomAD is considered unreliable, as metrics indicate poor data quality at this position. c.105_135del31 has been reported in the literature in the heterozgyous state in at least one individual affected with breast cancer and glioblastoma (Susswein_1026). The following publication have been ascertained in the context of this evaluation (PMID: 26681312). ClinVar contains an entry for this variant (Variation ID: 182703). Based on the evidence outlined above, the variant was classified as pathogenic. -

Nov 07, 2021

Genome-Nilou Lab

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1 Uncertain:1

Nov 10, 2021

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Has not been previously published as pathogenic or benign to our knowledge -

Jun 01, 2020

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The variant results in a shift of the reading frame, and is therefore predicted to result in the loss of a functional protein. Found in at least one patient with expected phenotype for this gene, and not found in general population data. -

Aplastic anemia Pathogenic:1

Dec 04, 2023

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Pathogenic:1

Jun 30, 2020

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.105_135del31 pathogenic mutation, located in coding exon 2 of the NBN gene, results from a deletion of 31 nucleotides at nucleotide positions 105 to 135, causing a translational frameshift with a predicted alternate stop codon (p.I35Mfs*4). This alteration was identified in 1/10030 consecutive patients referred for evaluation by an NGS hereditary cancer panel. This patient had a personal history of breast cancer and glioblastoma (Susswein LR et al. Genet. Med., 2016 08;18:823-32). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs730881840; hg19: chr8-90994985;