rs74315128
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3
The NM_001171.6(ABCC6):c.3823_3870delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC(p.Arg1275_His1290del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).
Frequency
Consequence
NM_001171.6 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- arterial calcification, generalized, of infancy, 2Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
- autosomal recessive inherited pseudoxanthoma elasticumInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, G2P, Orphanet
- inherited pseudoxanthoma elasticumInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- arterial calcification of infancyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001171.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ABCC6 | MANE Select | c.3823_3870delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC | p.Arg1275_His1290del | conservative_inframe_deletion | Exon 27 of 31 | NP_001162.5 | |||
| ABCC6 | c.3790_3837delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC | p.Arg1264_His1279del | conservative_inframe_deletion | Exon 27 of 31 | NP_001427238.1 | ||||
| ABCC6 | c.3655_3702delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC | p.Arg1219_His1234del | conservative_inframe_deletion | Exon 26 of 30 | NP_001427239.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ABCC6 | TSL:1 MANE Select | c.3823_3870delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC | p.Arg1275_His1290del | conservative_inframe_deletion | Exon 27 of 31 | ENSP00000205557.7 | O95255-1 | ||
| ABCC6 | c.3919_3966delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC | p.Arg1307_His1322del | conservative_inframe_deletion | Exon 28 of 32 | ENSP00000579142.1 | ||||
| ABCC6 | c.3916_3963delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC | p.Arg1306_His1321del | conservative_inframe_deletion | Exon 28 of 32 | ENSP00000579149.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.