rs750035706

Variant names:

• chr19-54180848-CCGGCGGCAATGCAGCCGCACT-C
• rs750035706
• NM_024298.5:c.758_778delAGTGCGGCTGCATTGCCGCCG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PM4 PP5_Very_Strong

The NM_024298.5(MBOAT7):​c.758_778delAGTGCGGCTGCATTGCCGCCG​(p.Glu253_Ala259del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000525 in 1,579,556 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000057 (0 hom.)
• Consequence: MBOAT7 NM_024298.5 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:8
• Conservation: PhyloP100: 5.56
• Publications: 1 publications found

Genes affected

MBOAT7 (HGNC:15505): (membrane bound O-acyltransferase domain containing 7) This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an acyl donor. This protein is involved in the reacylation of phospholipids as part of the phospholipid remodeling pathway known as the Land cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]

MBOAT7 Gene-Disease associations (from GenCC):

• complex neurodevelopmental disorder

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• intellectual disability, autosomal recessive 57

  Inheritance: AR Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• autosomal recessive non-syndromic intellectual disability

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_024298.5.
• PP5: Variant 19-54180848-CCGGCGGCAATGCAGCCGCACT-C is Pathogenic according to our data. Variant chr19-54180848-CCGGCGGCAATGCAGCCGCACT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 268112.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_024298.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MBOAT7	NM_024298.5	MANE Select	c.758_778delAGTGCGGCTGCATTGCCGCCG	p.Glu253_Ala259del	disruptive_inframe_deletion	Exon 6 of 8	NP_077274.3
	MBOAT7	NM_001146056.3		c.539_559delAGTGCGGCTGCATTGCCGCCG	p.Glu180_Ala186del	disruptive_inframe_deletion	Exon 4 of 6	NP_001139528.1	Q96N66-2
	MBOAT7	NM_001146083.3		c.539_559delAGTGCGGCTGCATTGCCGCCG	p.Glu180_Ala186del	disruptive_inframe_deletion	Exon 5 of 7	NP_001139555.1	Q96N66-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MBOAT7	ENST00000245615.6	TSL:1 MANE Select	c.758_778delAGTGCGGCTGCATTGCCGCCG	p.Glu253_Ala259del	disruptive_inframe_deletion	Exon 6 of 8	ENSP00000245615.1	Q96N66-1
	MBOAT7	ENST00000431666.6	TSL:1	c.539_559delAGTGCGGCTGCATTGCCGCCG	p.Glu180_Ala186del	disruptive_inframe_deletion	Exon 5 of 7	ENSP00000410503.2	Q96N66-2
	MBOAT7	ENST00000391754.5	TSL:1	c.758_778delAGTGCGGCTGCATTGCCGCCG	p.Glu253_Ala259del	disruptive_inframe_deletion	Exon 6 of 7	ENSP00000375634.1	Q96N66-3

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152202 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000219 AC: 4 AN: 182932 AF XY: 0.0000301

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000574 AC: 82 AN: 1427354 Hom.: 0 AF XY: 0.0000622 AC XY: 44 AN XY: 707032

African (AFR) AF: 0.00 AC: 0 AN: 33150

American (AMR) AF: 0.00 AC: 0 AN: 37782

Ashkenazi Jewish (ASJ) AF: 0.0000393 AC: 1 AN: 25414

East Asian (EAS) AF: 0.00 AC: 0 AN: 38614

South Asian (SAS) AF: 0.000146 AC: 12 AN: 82024

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 47944

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5370

European-Non Finnish (NFE) AF: 0.0000619 AC: 68 AN: 1097818

Other (OTH) AF: 0.0000169 AC: 1 AN: 59238

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152202 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 74356

African (AFR) AF: 0.00 AC: 0 AN: 41450

American (AMR) AF: 0.00 AC: 0 AN: 15280

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5184

South Asian (SAS) AF: 0.00 AC: 0 AN: 4838

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10620

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68038

Other (OTH) AF: 0.00 AC: 0 AN: 2094

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000189

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
5	-	-	Intellectual disability, autosomal recessive 57 (5)
2	-	-	not provided (2)
1	-	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.6
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs750035706; hg19: chr19-54684565;