rs755789146

Positions:

• chr4-5665625-CGTGGAGGCCGTGGTGCGGCAGAACCT-C

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Moderate PM2 PP5_Very_Strong

The NM_147127.5(EVC2):​c.871-2_894delAGGTTCTGCCGCACCACGGCCTCCAC​(p.Val291_Ala299del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,864 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: EVC2 NM_147127.5 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 3.16

Genes affected

EVC2 (HGNC:19747): (EvC ciliary complex subunit 2) This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.03412274 fraction of the gene. Cryptic splice site detected, with MaxEntScore 8.4, offset of 28, new splice context is: ctcctcttgtctccacgcAGcag. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-5665625-CGTGGAGGCCGTGGTGCGGCAGAACCT-C is Pathogenic according to our data. Variant chr4-5665625-CGTGGAGGCCGTGGTGCGGCAGAACCT-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 553798.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
EVC2	NM_147127.5	c.871-2_894delAGGTTCTGCCGCACCACGGCCTCCAC	p.Val291_Ala299del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	8/22	ENST00000344408.10	NP_667338.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
EVC2	ENST00000344408.10	c.871-2_894delAGGTTCTGCCGCACCACGGCCTCCAC	p.Val291_Ala299del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	8/22	1	NM_147127.5	ENSP00000342144.5
EVC2	ENST00000310917.6	c.631-2_654delAGGTTCTGCCGCACCACGGCCTCCAC	p.Val211_Ala219del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	8/22	1		ENSP00000311683.2
EVC2	ENST00000475313.5	n.631-2_654delAGGTTCTGCCGCACCACGGCCTCCAC		splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	8/23	1		ENSP00000431981.1
EVC2	ENST00000509670.1	n.631-2_654delAGGTTCTGCCGCACCACGGCCTCCAC		splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	9/23	1		ENSP00000423876.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.00000398 AC: 1 AN: 251336 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 135844

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000544

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461864 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727244

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000252

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

Bravo AF: 0.0000113

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Ellis-van Creveld syndrome;C0457013:Curry-Hall syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 21, 2023

For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 553798). This variant has been observed in individual(s) with Ellis-van Creveld syndrome (PMID: 21199751). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. It has also been observed to segregate with disease in related individuals. This variant is present in population databases (rs755789146, gnomAD 0.006%). This variant results in the deletion of part of exon 8 (c.871-2_894del) of the EVC2 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in EVC2 are known to be pathogenic (PMID: 17024374, 19810119, 19876929). -

Ellis-van Creveld syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Counsyl

Sep 07, 2017

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs755789146; hg19: chr4-5667352;