rs755789146

Variant names:

• chr4-5665625-CGTGGAGGCCGTGGTGCGGCAGAACCT-C
• rs755789146
• NM_147127.5:c.871-2_894delAGGTTCTGCCGCACCACGGCCTCCAC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_Moderate PP5_Very_Strong

The NM_147127.5(EVC2):​c.871-2_894delAGGTTCTGCCGCACCACGGCCTCCAC​(p.Val291_Ala299del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,864 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: EVC2 NM_147127.5 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 3.16
• Publications: 3 publications found

Genes affected

EVC2 (HGNC:19747): (EvC ciliary complex subunit 2) This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]

EVC2 Gene-Disease associations (from GenCC):

• acrofacial dysostosis, Weyers type

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Orphanet
• Ellis-van Creveld syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Myriad Women’s Health, Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics, Laboratory for Molecular Medicine

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.03437739 fraction of the gene. Cryptic splice site detected, with MaxEntScore 8.4, offset of 28, new splice context is: ctcctcttgtctccacgcAGcag. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PP5: Variant 4-5665625-CGTGGAGGCCGTGGTGCGGCAGAACCT-C is Pathogenic according to our data. Variant chr4-5665625-CGTGGAGGCCGTGGTGCGGCAGAACCT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 553798.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_147127.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EVC2	NM_147127.5	MANE Select	c.871-2_894delAGGTTCTGCCGCACCACGGCCTCCAC	p.Val291_Ala299del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 8 of 22	NP_667338.3
	EVC2	NM_001166136.2		c.631-2_654delAGGTTCTGCCGCACCACGGCCTCCAC	p.Val211_Ala219del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 8 of 22	NP_001159608.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EVC2	ENST00000344408.10	TSL:1 MANE Select	c.871-2_894delAGGTTCTGCCGCACCACGGCCTCCAC	p.Val291_Ala299del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 8 of 22	ENSP00000342144.5
	EVC2	ENST00000310917.6	TSL:1	c.631-2_654delAGGTTCTGCCGCACCACGGCCTCCAC	p.Val211_Ala219del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 8 of 22	ENSP00000311683.2
	EVC2	ENST00000475313.5	TSL:1	n.631-2_654delAGGTTCTGCCGCACCACGGCCTCCAC		splice_acceptor splice_region intron non_coding_transcript_exon	Exon 8 of 23	ENSP00000431981.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251336 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000544

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461864 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727244

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53410

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1112006

Other (OTH) AF: 0.00 AC: 0 AN: 60390

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000113

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Ellis-van Creveld syndrome (2)
1	-	-	Ellis-van Creveld syndrome;C0457013:Curry-Hall syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.2
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs755789146; hg19: chr4-5667352;