rs759449495
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_006231.4(POLE):c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG(p.Leu1287_Arg1294del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000479 in 1,460,678 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. R1286R) has been classified as Likely benign.
Frequency
Consequence
NM_006231.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- POLE-related polyposis and colorectal cancer syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- colorectal cancer, susceptibility to, 12Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
- facial dysmorphism-immunodeficiency-livedo-short stature syndromeInheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet
- intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiencyInheritance: AR Classification: STRONG Submitted by: G2P
- IMAGe syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Polymerase proofreading-related adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_006231.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLE | TSL:1 MANE Select | c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG | p.Leu1287_Arg1294del | disruptive_inframe_deletion | Exon 31 of 49 | ENSP00000322570.5 | Q07864 | ||
| POLE | TSL:1 | c.3777_3800delCCTCGCCCGCAGGAAGAGGCAGCG | p.Leu1260_Arg1267del | disruptive_inframe_deletion | Exon 30 of 48 | ENSP00000445753.1 | F5H1D6 | ||
| POLE | TSL:1 | n.*3609_*3632delCCTCGCCCGCAGGAAGAGGCAGCG | non_coding_transcript_exon | Exon 31 of 49 | ENSP00000442578.1 | F5H7E4 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD2 exomes AF: 0.00000406 AC: 1AN: 246580 AF XY: 0.00 show subpopulations
GnomAD4 exome AF: 0.00000479 AC: 7AN: 1460678Hom.: 0 AF XY: 0.00000275 AC XY: 2AN XY: 726658 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.