rs759449495

Positions:

• chr12-132649429-ACGCTGCCTCTTCCTGCGGGCGAGG-A

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_006231.4(POLE):​c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG​(p.Leu1287_Arg1294del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000479 in 1,460,678 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000048 (0 hom.)
• Consequence: POLE NM_006231.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 7.52

Genes affected

POLE (HGNC:9177): (DNA polymerase epsilon, catalytic subunit) This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]

POLE (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006231.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
POLE	NM_006231.4	c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG	p.Leu1287_Arg1294del	disruptive_inframe_deletion	31/49	ENST00000320574.10	NP_006222.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
POLE	ENST00000320574.10	c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG	p.Leu1287_Arg1294del	disruptive_inframe_deletion	31/49	1	NM_006231.4	ENSP00000322570.5

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000479 AC: 7 AN: 1460678 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 726658

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000629

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000378

Asia WGS AF: 0.000289 AC: 1 AN: 3478

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital

Aug 15, 2023

- -

Colorectal cancer, susceptibility to, 12 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Oct 18, 2022

This variant, c.3858_3881del, results in the deletion of 8 amino acid(s) of the POLE protein (p.Ala1288_Leu1295del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs759449495, gnomAD 0.0009%). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 422681). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Jun 30, 2023

In-frame deletion of 8 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge; This variant is associated with the following publications: (PMID: 37250013) -

Hereditary cancer-predisposing syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

Nov 20, 2018

The c.3858_3881del24 variant (also known as p.A1288_L1295del) is located in coding exon 31 of the POLE gene. This variant results from an in-frame deletion of 24 nucleotides at positions 1288 to 1295. This results in the deletion of 8 amino acids between codons 3858 and 3881. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs759449495; hg19: chr12-133226015;