rs759449495

Variant names:

• chr12-132649429-ACGCTGCCTCTTCCTGCGGGCGAGG-A
• rs759449495
• NM_006231.4:c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_006231.4(POLE):​c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG​(p.Leu1287_Arg1294del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000479 in 1,460,678 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. R1286R) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000048 (0 hom.)
• Consequence: POLE NM_006231.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 7.52
• Publications: 0 publications found

Genes affected

POLE (HGNC:9177): (DNA polymerase epsilon, catalytic subunit) This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]

POLE Gene-Disease associations (from GenCC):

• POLE-related polyposis and colorectal cancer syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• colorectal cancer, susceptibility to, 12

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• facial dysmorphism-immunodeficiency-livedo-short stature syndrome

  Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
• intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiency

  Inheritance: AR Classification: STRONG Submitted by: G2P
• IMAGe syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Polymerase proofreading-related adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006231.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006231.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLE	NM_006231.4	MANE Select	c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG	p.Leu1287_Arg1294del	disruptive_inframe_deletion	Exon 31 of 49	NP_006222.2	Q07864

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLE	ENST00000320574.10	TSL:1 MANE Select	c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG	p.Leu1287_Arg1294del	disruptive_inframe_deletion	Exon 31 of 49	ENSP00000322570.5	Q07864
	POLE	ENST00000535270.5	TSL:1	c.3777_3800delCCTCGCCCGCAGGAAGAGGCAGCG	p.Leu1260_Arg1267del	disruptive_inframe_deletion	Exon 30 of 48	ENSP00000445753.1	F5H1D6
	POLE	ENST00000537064.5	TSL:1	n.*3609_*3632delCCTCGCCCGCAGGAAGAGGCAGCG		non_coding_transcript_exon	Exon 31 of 49	ENSP00000442578.1	F5H7E4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.00000406 AC: 1 AN: 246580 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000905

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000479 AC: 7 AN: 1460678 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 726658

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52272

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5732

European-Non Finnish (NFE) AF: 0.00000629 AC: 7 AN: 1112000

Other (OTH) AF: 0.00 AC: 0 AN: 60380

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000000155054), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

Asia WGS AF: 0.000289 AC: 1 AN: 3478

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	2	-	not provided (2)
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.5
Mutation Taster		=35/165	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs759449495; hg19: chr12-133226015;