rs759449495

Variant names:

• chr12-132649429-ACGCTGCCTCTTCCTGCGGGCGAGG-A
• rs759449495
• NM_006231.4:c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_006231.4(POLE):​c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG​(p.Leu1287_Arg1294del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000479 in 1,460,678 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. R1286R) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000048 (0 hom.)
• Consequence: POLE NM_006231.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 7.52
• Publications: 0 publications found

Genes affected

POLE (HGNC:9177): (DNA polymerase epsilon, catalytic subunit) This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]

POLE Gene-Disease associations (from GenCC):

• POLE-related polyposis and colorectal cancer syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• colorectal cancer, susceptibility to, 12

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• facial dysmorphism-immunodeficiency-livedo-short stature syndrome

  Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
• intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiency

  Inheritance: AR Classification: STRONG Submitted by: G2P
• IMAGe syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Polymerase proofreading-related adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006231.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLE	NM_006231.4	c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG	p.Leu1287_Arg1294del	disruptive_inframe_deletion	Exon 31 of 49	ENST00000320574.10	NP_006222.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLE	ENST00000320574.10	c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG	p.Leu1287_Arg1294del	disruptive_inframe_deletion	Exon 31 of 49	1	NM_006231.4	ENSP00000322570.5

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.00000406 AC: 1 AN: 246580 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000905

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000479 AC: 7 AN: 1460678 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 726658

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52272

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5732

European-Non Finnish (NFE) AF: 0.00000629 AC: 7 AN: 1112000

Other (OTH) AF: 0.00 AC: 0 AN: 60380

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000000155054), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

Asia WGS AF: 0.000289 AC: 1 AN: 3478

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:2

Jun 30, 2023

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame deletion of 8 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge; This variant is associated with the following publications: (PMID: 37250013) -

Nov 10, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.3858_3881del, results in the deletion of 8 amino acid(s) of the POLE protein (p.Ala1288_Leu1295del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs759449495, gnomAD 0.0009%). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 422681). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not specified Uncertain:1

Mar 04, 2025

Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Uncertain:1

Jan 07, 2025

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3858_3881del24 variant (also known as p.A1288_L1295del) is located in coding exon 31 of the POLE gene. This variant results from an in-frame deletion of 24 nucleotides at positions 1288 to 1295. This results in the deletion of 8 amino acids between codons 3858 and 3881. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.5
Mutation Taster		=35/165	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs759449495; hg19: chr12-133226015;