rs767081975
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_024422.6(DSC2):c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT(p.Gly193_Ser208del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. G193G) has been classified as Likely benign.
Frequency
Consequence
NM_024422.6 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- familial isolated arrhythmogenic right ventricular dysplasiaInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- arrhythmogenic right ventricular dysplasia 11Inheritance: AR, SD, AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
- colorectal adenomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_024422.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DSC2 | MANE Select | c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT | p.Gly193_Ser208del | conservative_inframe_deletion | Exon 5 of 16 | NP_077740.1 | Q02487-1 | ||
| DSC2 | c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT | p.Gly193_Ser208del | conservative_inframe_deletion | Exon 5 of 17 | NP_004940.1 | Q02487-2 | |||
| DSC2 | c.148_195delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT | p.Gly50_Ser65del | conservative_inframe_deletion | Exon 5 of 16 | NP_001393435.1 | A0A3B3ISU0 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DSC2 | TSL:1 MANE Select | c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT | p.Gly193_Ser208del | conservative_inframe_deletion | Exon 5 of 16 | ENSP00000280904.6 | Q02487-1 | ||
| DSC2 | TSL:1 | c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT | p.Gly193_Ser208del | conservative_inframe_deletion | Exon 5 of 17 | ENSP00000251081.6 | Q02487-2 | ||
| DSC2 | c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT | p.Gly193_Ser208del | conservative_inframe_deletion | Exon 5 of 16 | ENSP00000519010.1 | A0AAQ5BGP6 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD2 exomes AF: 0.00000398 AC: 1AN: 251374 AF XY: 0.00 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000889 AC: 13AN: 1461528Hom.: 0 AF XY: 0.0000110 AC XY: 8AN XY: 727084 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.