rs767081975

Variant names:

• chr18-31089444-AAGATTCATACTGCTCACGATCTACAGGACGAGTACAATACAAGTTTCC-A
• rs767081975
• NM_024422.6:c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_024422.6(DSC2):​c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT​(p.Gly193_Ser208del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000089 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: DSC2 NM_024422.6 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 5.74

Genes affected

DSC2 (HGNC:3036): (desmocollin 2) This gene encodes a member of the desmocollin protein subfamily. Desmocollins, along with desmogleins, are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. This gene is found in a cluster with other desmocollin family members on chromosome 18. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia-11, and reduced protein expression has been described in several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_024422.6.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DSC2	NM_024422.6	c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly193_Ser208del	conservative_inframe_deletion	Exon 5 of 16	ENST00000280904.11	NP_077740.1
DSC2	NM_004949.5	c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly193_Ser208del	conservative_inframe_deletion	Exon 5 of 17		NP_004940.1
DSC2	NM_001406506.1	c.148_195delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly50_Ser65del	conservative_inframe_deletion	Exon 5 of 16		NP_001393435.1
DSC2	NM_001406507.1	c.148_195delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly50_Ser65del	conservative_inframe_deletion	Exon 5 of 17		NP_001393436.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DSC2	ENST00000280904.11	c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly193_Ser208del	conservative_inframe_deletion	Exon 5 of 16	1	NM_024422.6	ENSP00000280904.6
DSC2	ENST00000251081.8	c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly193_Ser208del	conservative_inframe_deletion	Exon 5 of 17	1		ENSP00000251081.6
DSC2	ENST00000648081.1	c.148_195delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly50_Ser65del	conservative_inframe_deletion	Exon 6 of 17			ENSP00000497441.1
DSC2	ENST00000682357.1	c.148_195delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly50_Ser65del	conservative_inframe_deletion	Exon 5 of 16			ENSP00000507826.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000889 AC: 13 AN: 1461528 Hom.: 0 AF XY: 0.0000110 AC XY: 8 AN XY: 727084

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000117

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Arrhythmogenic right ventricular dysplasia 11 Uncertain:1

Jun 24, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant disrupts a region of the DSC2 protein in which other variant(s) (p.Arg203Cys) have been observed in individuals with DSC2-related conditions (PMID: 21062920). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 536275). This variant has been observed in individual(s) with arrhythmogenic cardiomyopathy (PMID: 34393635). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant, c.577_624del, results in the deletion of 16 amino acid(s) of the DSC2 protein (p.Gly193_Ser208del), but otherwise preserves the integrity of the reading frame. -

Cardiomyopathy Uncertain:1

Jan 27, 2023

Color Diagnostics, LLC DBA Color Health

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of 16 amino acids of the DSC2 protein. To our knowledge, functional studies have not been reported for this variant. This variant has been reported in an individual affected with arrhythmogenic right ventricular cardiomyopathy (PMID: 34393635). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs767081975; hg19: chr18-28669407;