rs767081975

Variant names:

• chr18-31089444-AAGATTCATACTGCTCACGATCTACAGGACGAGTACAATACAAGTTTCC-A
• rs767081975
• NM_024422.6:c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_024422.6(DSC2):​c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT​(p.Gly193_Ser208del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. G193G) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000089 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: DSC2 NM_024422.6 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 5.74
• Publications: 1 publications found

Genes affected

DSC2 (HGNC:3036): (desmocollin 2) This gene encodes a member of the desmocollin protein subfamily. Desmocollins, along with desmogleins, are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. This gene is found in a cluster with other desmocollin family members on chromosome 18. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia-11, and reduced protein expression has been described in several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]

DSC2 Gene-Disease associations (from GenCC):

• familial isolated arrhythmogenic right ventricular dysplasia

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• arrhythmogenic right ventricular dysplasia 11

  Inheritance: AR, SD, AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
• colorectal adenoma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_024422.6.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_024422.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DSC2	NM_024422.6	MANE Select	c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly193_Ser208del	conservative_inframe_deletion	Exon 5 of 16	NP_077740.1	Q02487-1
	DSC2	NM_004949.5		c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly193_Ser208del	conservative_inframe_deletion	Exon 5 of 17	NP_004940.1	Q02487-2
	DSC2	NM_001406506.1		c.148_195delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly50_Ser65del	conservative_inframe_deletion	Exon 5 of 16	NP_001393435.1	A0A3B3ISU0

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DSC2	ENST00000280904.11	TSL:1 MANE Select	c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly193_Ser208del	conservative_inframe_deletion	Exon 5 of 16	ENSP00000280904.6	Q02487-1
	DSC2	ENST00000251081.8	TSL:1	c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly193_Ser208del	conservative_inframe_deletion	Exon 5 of 17	ENSP00000251081.6	Q02487-2
	DSC2	ENST00000713707.1		c.577_624delGGAAACTTGTATTGTACTCGTCCTGTAGATCGTGAGCAGTATGAATCT	p.Gly193_Ser208del	conservative_inframe_deletion	Exon 5 of 16	ENSP00000519010.1	A0AAQ5BGP6

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251374 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000880

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000889 AC: 13 AN: 1461528 Hom.: 0 AF XY: 0.0000110 AC XY: 8 AN XY: 727084

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33458

American (AMR) AF: 0.00 AC: 0 AN: 44718

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26122

East Asian (EAS) AF: 0.00 AC: 0 AN: 39644

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53388

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5764

European-Non Finnish (NFE) AF: 0.0000117 AC: 13 AN: 1111808

Other (OTH) AF: 0.00 AC: 0 AN: 60372

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Arrhythmogenic right ventricular dysplasia 11 (1)
-	1	-	Cardiomyopathy (1)
-	1	-	Cardiovascular phenotype (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs767081975;

hg19: chr18-28669407;