rs770089708

Variant names:

• chr17-4933925-TCAGAGCCCGCCCCCAGCCCGACC-T
• rs770089708
• NM_000173.7:c.1322_1344delCAGAGCCCGCCCCCAGCCCGACC

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 8P and 16B. PVS1 BP6_Very_Strong BA1

The NM_000173.7(GP1BA):​c.1322_1344delCAGAGCCCGCCCCCAGCCCGACC​(p.Ser441TyrfsTer49) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). The gene GP1BA is included in the ClinGen Criteria Specification Registry.

• Frequency:
  • Genomes: 𝑓 0.40 (859 hom., cov: 0)
  • Exomes 𝑓: 0.15 (4834 hom.)
  • Failed GnomAD Quality Control
• Consequence: GP1BA NM_000173.7 frameshift
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: 1.20
• Publications: 4 publications found

Genes affected

GP1BA (HGNC:4439): (glycoprotein Ib platelet subunit alpha) Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy. [provided by RefSeq, Oct 2013]

CHRNE (HGNC:1966): (cholinergic receptor nicotinic epsilon subunit) Acetylcholine receptors at mature mammalian neuromuscular junctions are pentameric protein complexes composed of four subunits in the ratio of two alpha subunits to one beta, one epsilon, and one delta subunit. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. Mutations in the epsilon subunit are associated with congenital myasthenic syndrome. [provided by RefSeq, Sep 2009]

CHRNE Gene-Disease associations (from GenCC):

• congenital myasthenic syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: Illumina
• congenital myasthenic syndrome 4A

  Inheritance: AD, AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• congenital myasthenic syndrome 4B

  Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• congenital myasthenic syndrome 4C

  Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
• postsynaptic congenital myasthenic syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for GP1BA are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Benign. The variant received -8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 22 pathogenic variants in the truncated region.
• BP6: Variant 17-4933925-TCAGAGCCCGCCCCCAGCCCGACC-T is Benign according to our data. Variant chr17-4933925-TCAGAGCCCGCCCCCAGCCCGACC-T is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 435346.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (SAS) allele frequency at 95% confidence interval = 0.467 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000173.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GP1BA	NM_000173.7	MANE Select	c.1322_1344delCAGAGCCCGCCCCCAGCCCGACC	p.Ser441TyrfsTer49	frameshift	Exon 2 of 2	NP_000164.5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GP1BA	ENST00000329125.6	TSL:1 MANE Select	c.1322_1344delCAGAGCCCGCCCCCAGCCCGACC	p.Ser441TyrfsTer49	frameshift	Exon 2 of 2	ENSP00000329380.5	P07359
	CHRNE	ENST00000649830.1		c.-888+394_-888+416delGGTCGGGCTGGGGGCGGGCTCTG		intron	N/A	ENSP00000496907.1	A0A3B3IRM1

Frequencies

GnomAD3 genomes AF: 0.405 AC: 11099 AN: 27408 Hom.: 859 Cov.: 0

Gnomad AFR AF: 0.294

Gnomad AMI AF: 0.495

Gnomad AMR AF: 0.436

Gnomad ASJ AF: 0.330

Gnomad EAS AF: 0.379

Gnomad SAS AF: 0.494

Gnomad FIN AF: 0.388

Gnomad MID AF: 0.354

Gnomad NFE AF: 0.433

Gnomad OTH AF: 0.387

GnomAD2 exomes AF: 0.109 AC: 9489 AN: 87154 AF XY: 0.100

Gnomad AFR exome AF: 0.165

Gnomad AMR exome AF: 0.169

Gnomad ASJ exome AF: 0.0223

Gnomad EAS exome AF: 0.253

Gnomad FIN exome AF: 0.0376

Gnomad NFE exome AF: 0.0930

Gnomad OTH exome AF: 0.138

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.146 AC: 60871 AN: 417474 Hom.: 4834 AF XY: 0.153 AC XY: 34026 AN XY: 221674

African (AFR) AF: 0.0908 AC: 706 AN: 7774

American (AMR) AF: 0.153 AC: 2472 AN: 16206

Ashkenazi Jewish (ASJ) AF: 0.0812 AC: 984 AN: 12124

East Asian (EAS) AF: 0.238 AC: 5025 AN: 21146

South Asian (SAS) AF: 0.245 AC: 12260 AN: 50078

European-Finnish (FIN) AF: 0.128 AC: 3366 AN: 26278

Middle Eastern (MID) AF: 0.106 AC: 196 AN: 1844

European-Non Finnish (NFE) AF: 0.124 AC: 32501 AN: 262088

Other (OTH) AF: 0.169 AC: 3361 AN: 19936

GnomAD4 genome AF: 0.405 AC: 11102 AN: 27426 Hom.: 859 Cov.: 0 AF XY: 0.396 AC XY: 5271 AN XY: 13326

African (AFR) AF: 0.293 AC: 1373 AN: 4680

American (AMR) AF: 0.435 AC: 1221 AN: 2806

Ashkenazi Jewish (ASJ) AF: 0.330 AC: 192 AN: 582

East Asian (EAS) AF: 0.380 AC: 678 AN: 1786

South Asian (SAS) AF: 0.495 AC: 845 AN: 1708

European-Finnish (FIN) AF: 0.388 AC: 598 AN: 1540

Middle Eastern (MID) AF: 0.313 AC: 15 AN: 48

European-Non Finnish (NFE) AF: 0.433 AC: 5947 AN: 13736

Other (OTH) AF: 0.393 AC: 133 AN: 338

Alfa AF: 0.0460 Hom.: 17

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not specified (2)
-	-	1	Bernard Soulier syndrome;C1280798:Pseudo von Willebrand disease;C1847711:Nonarteritic anterior ischemic optic neuropathy, susceptibility to;C3277076:Bernard-Soulier syndrome, type A2, autosomal dominant (1)
-	-	1	GP1BA-related disorder (1)
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.2
Mutation Taster		=134/66	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs770089708; hg19: chr17-4837220; COSMIC: COSV99851242; COSMIC: COSV99851242;