rs771146489

Positions:

• chr11-108335940-ATTAACTATCTGTACTTATAAG-A

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_000051.4(ATM):​c.8248_8268del​(p.Leu2750_Lys2756del) variant causes a inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000685 in 1,459,608 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: ATM NM_000051.4 inframe_deletion, splice_region
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:2 U:2
• Conservation: PhyloP100: 7.57

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000051.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-108335940-ATTAACTATCTGTACTTATAAG-A is Pathogenic according to our data. Variant chr11-108335940-ATTAACTATCTGTACTTATAAG-A is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 422777.We mark this variant Likely_pathogenic, oryginal submissions are: {Likely_pathogenic=2, Uncertain_significance=2}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATM	NM_000051.4	c.8248_8268del	p.Leu2750_Lys2756del	inframe_deletion, splice_region_variant	56/63	ENST00000675843.1	NP_000042.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATM	ENST00000675843.1	c.8248_8268del	p.Leu2750_Lys2756del	inframe_deletion, splice_region_variant	56/63		NM_000051.4	ENSP00000501606	P1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.00000398 AC: 1 AN: 251022 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 135656

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.0000994

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.85e-7 AC: 1 AN: 1459608 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 726306

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.0000166

GnomAD4 genome Cov.: 32

Alfa AF: 0.000111 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:2 Uncertain:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Nov 03, 2023

The c.8248_8268del21 variant (also known as p.L2750_K2756del) is located in coding exon 55 of the ATM gene. This variant results from an in-frame TTAACTATCTGTACTTATAAG deletion at nucleotide positions 8248 to 8268. This leads to the in-frame deletion of seven residues (LTICTYK) from codon 2750 to codon 2756. This nucleotide region is well conserved in available vertebrate species. This deletion includes the last base pair of coding exon 55, which makes it likely to have some effect on normal mRNA splicing. In silico splice site analysis predicts that this alteration will weaken the native splice donor site.. RNA studies have demonstrated that this alteration results in an abnormal splicing in the set of samples tested (Ambry internal data). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Familial cancer of breast Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Myriad Genetics, Inc.

Feb 02, 2024

This variant is considered likely pathogenic. mRNA analysis has demonstrated abnormal mRNA splicing occurs [Myriad internal data]. -

Ataxia-telangiectasia syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Oct 28, 2023

This variant, c.8248_8268del, results in the deletion of 7 amino acid(s) of the ATM protein (p.Leu2750_Lys2756del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs771146489, gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ATM-related conditions. ClinVar contains an entry for this variant (Variation ID: 422777). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Nov 29, 2016

This in-frame deletion of 21 nucleotides in ATM is denoted c.8248_8268del21 at the cDNA level and p.Leu2750_Lys2756del (L2750_K2756del) at the protein level. The normal sequence, with the bases that are deleted in brackets, is GAAA[del21]gtaa. This variant has not, to our knowledge, been published in the literature as pathogenic or benign. ATM Leu2750_Lys2756del was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, suggesting it is not a common benign variant in these populations. The deleted residues are either conserved, conserved by class, or conserved through mammals, and are located in the kinase domain (Stracker 2013). Multiple splicing models predict that this variant may destroy the natural splice donor site for intron 56 and lead to abnormal splicing. However, in the absence of RNA or functional studies, the actual effect of this variant is unknown. Since in-frame deletions may or may not inhibit proper protein functioning, the clinical significance of this finding remains unclear at this time and we consider ATM Leu2750_Lys2756del to be a variant of uncertain significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs771146489; hg19: chr11-108206667;