rs771146489

Variant names:

• chr11-108335940-ATTAACTATCTGTACTTATAAG-A
• rs771146489
• NM_000051.4:c.8248_8268delTTAACTATCTGTACTTATAAG

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_000051.4(ATM):​c.8248_8268delTTAACTATCTGTACTTATAAG​(p.Leu2750_Lys2756del) variant causes a conservative inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000685 in 1,459,608 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. L2750L) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: ATM NM_000051.4 conservative_inframe_deletion, splice_region
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:2 U:2
• Conservation: PhyloP100: 7.57
• Publications: 0 publications found

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 37 uncertain in NM_000051.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000051.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-108335940-ATTAACTATCTGTACTTATAAG-A is Pathogenic according to our data. Variant chr11-108335940-ATTAACTATCTGTACTTATAAG-A is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 422777.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000051.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATM	NM_000051.4	MANE Select	c.8248_8268delTTAACTATCTGTACTTATAAG	p.Leu2750_Lys2756del	conservative_inframe_deletion splice_region	Exon 56 of 63	NP_000042.3
	ATM	NM_001351834.2		c.8248_8268delTTAACTATCTGTACTTATAAG	p.Leu2750_Lys2756del	conservative_inframe_deletion splice_region	Exon 57 of 64	NP_001338763.1
	C11orf65	NM_001330368.2		c.641-26890_641-26870delCTTATAAGTACAGATAGTTAA		intron	N/A	NP_001317297.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATM	ENST00000675843.1	MANE Select	c.8248_8268delTTAACTATCTGTACTTATAAG	p.Leu2750_Lys2756del	conservative_inframe_deletion splice_region	Exon 56 of 63	ENSP00000501606.1
	ATM	ENST00000452508.7	TSL:1	c.8248_8268delTTAACTATCTGTACTTATAAG	p.Leu2750_Lys2756del	conservative_inframe_deletion splice_region	Exon 57 of 64	ENSP00000388058.2
	ATM	ENST00000527805.6	TSL:1	n.*3312_*3332delTTAACTATCTGTACTTATAAG		splice_region non_coding_transcript_exon	Exon 54 of 61	ENSP00000435747.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251022 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.0000994

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.85e-7 AC: 1 AN: 1459608 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 726306

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33418

American (AMR) AF: 0.00 AC: 0 AN: 44718

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26114

East Asian (EAS) AF: 0.00 AC: 0 AN: 39680

South Asian (SAS) AF: 0.00 AC: 0 AN: 86206

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53400

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5764

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1110010

Other (OTH) AF: 0.0000166 AC: 1 AN: 60298

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

Alfa AF: 0.000111 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	Ataxia-telangiectasia syndrome (1)
1	-	-	Familial cancer of breast (1)
1	-	-	Hereditary cancer-predisposing syndrome (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs771146489; hg19: chr11-108206667;