rs775364547

Variant names:

• chr16-89531960-CGGCCCCCCCGGCTGTGGGAAGACGCTGCT-C
• rs775364547
• NM_003119.4:c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_003119.4(SPG7):​c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC​(p.Pro350GlnfsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000477 in 1,613,946 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P350P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000046 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000048 (0 hom.)
• Consequence: SPG7 NM_003119.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: 9.65
• Publications: 1 publications found

Genes affected

SPG7 (HGNC:11237): (SPG7 matrix AAA peptidase subunit, paraplegin) This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2014]

SPG7 Gene-Disease associations (from GenCC):

• hereditary spastic paraplegia 7

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
• autosomal dominant optic atrophy

  Inheritance: AD Classification: STRONG Submitted by: PanelApp Australia
• lateral sclerosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-89531960-CGGCCCCCCCGGCTGTGGGAAGACGCTGCT-C is Pathogenic according to our data. Variant chr16-89531960-CGGCCCCCCCGGCTGTGGGAAGACGCTGCT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 495055.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003119.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPG7	NM_003119.4	MANE Select	c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC	p.Pro350GlnfsTer36	frameshift	Exon 8 of 17	NP_003110.1	Q9UQ90-1
	SPG7	NM_001363850.1		c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC	p.Pro350GlnfsTer36	frameshift	Exon 8 of 18	NP_001350779.1	A0A2R8Y3M4
	SPG7	NM_199367.3		c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC	p.Pro350GlnfsTer36	frameshift	Exon 8 of 10	NP_955399.1	Q9UQ90-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPG7	ENST00000645818.2	MANE Select	c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC	p.Pro350GlnfsTer36	frameshift	Exon 8 of 17	ENSP00000495795.2	Q9UQ90-1
	SPG7	ENST00000268704.7	TSL:1	c.1028_1056delCCCCCGGCTGTGGGAAGACGCTGCTGGCC	p.Pro343GlnfsTer36	frameshift	Exon 8 of 17	ENSP00000268704.3	A0A2U3TZH1
	SPG7	ENST00000341316.6	TSL:1	c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC	p.Pro350GlnfsTer36	frameshift	Exon 8 of 10	ENSP00000341157.2	Q9UQ90-2

Frequencies

GnomAD3 genomes AF: 0.0000460 AC: 7 AN: 152236 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000103

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000160 AC: 4 AN: 250546 AF XY: 0.0000221

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000354

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000479 AC: 70 AN: 1461710 Hom.: 0 AF XY: 0.0000509 AC XY: 37 AN XY: 727176

African (AFR) AF: 0.00 AC: 0 AN: 33472

American (AMR) AF: 0.00 AC: 0 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26118

East Asian (EAS) AF: 0.00 AC: 0 AN: 39694

South Asian (SAS) AF: 0.00 AC: 0 AN: 86252

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53388

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5754

European-Non Finnish (NFE) AF: 0.0000549 AC: 61 AN: 1111924

Other (OTH) AF: 0.000149 AC: 9 AN: 60388

GnomAD4 genome AF: 0.0000460 AC: 7 AN: 152236 Hom.: 0 Cov.: 32 AF XY: 0.0000269 AC XY: 2 AN XY: 74372

African (AFR) AF: 0.00 AC: 0 AN: 41464

American (AMR) AF: 0.00 AC: 0 AN: 15286

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5196

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10626

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.000103 AC: 7 AN: 68044

Other (OTH) AF: 0.00 AC: 0 AN: 2094

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000416

EpiCase AF: 0.0000545

EpiControl AF: 0.00

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
7	-	-	Hereditary spastic paraplegia 7 (7)
2	-	-	not provided (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.7
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs775364547; hg19: chr16-89598368;