rs775364547

Variant names:

• chr16-89531960-CGGCCCCCCCGGCTGTGGGAAGACGCTGCT-C
• rs775364547
• NM_003119.4:c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_003119.4(SPG7):​c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC​(p.Pro350GlnfsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000477 in 1,613,946 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000046 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000048 (0 hom.)
• Consequence: SPG7 NM_003119.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: 9.65

Genes affected

SPG7 (HGNC:11237): (SPG7 matrix AAA peptidase subunit, paraplegin) This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2014]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 16-89531960-CGGCCCCCCCGGCTGTGGGAAGACGCTGCT-C is Pathogenic according to our data. Variant chr16-89531960-CGGCCCCCCCGGCTGTGGGAAGACGCTGCT-C is described in ClinVar as [Pathogenic]. Clinvar id is 495055.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr16-89531960-CGGCCCCCCCGGCTGTGGGAAGACGCTGCT-C is described in Lovd as [Likely_pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SPG7	NM_003119.4	c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC	p.Pro350GlnfsTer36	frameshift_variant	Exon 8 of 17	ENST00000645818.2	NP_003110.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SPG7	ENST00000645818.2	c.1049_1077delCCCCCGGCTGTGGGAAGACGCTGCTGGCC	p.Pro350GlnfsTer36	frameshift_variant	Exon 8 of 17		NM_003119.4	ENSP00000495795.2

Frequencies

GnomAD3 genomes AF: 0.0000460 AC: 7 AN: 152236 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000103

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000160 AC: 4 AN: 250546 Hom.: 0 AF XY: 0.0000221 AC XY: 3 AN XY: 135636

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000354

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000479 AC: 70 AN: 1461710 Hom.: 0 AF XY: 0.0000509 AC XY: 37 AN XY: 727176

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000549

Gnomad4 OTH exome AF: 0.000149

GnomAD4 genome AF: 0.0000460 AC: 7 AN: 152236 Hom.: 0 Cov.: 32 AF XY: 0.0000269 AC XY: 2 AN XY: 74372

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000103

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000416

EpiCase AF: 0.0000545

EpiControl AF: 0.00

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:9

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary spastic paraplegia 7 Pathogenic:7

Jun 01, 2022

Solve-RD Consortium

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: provider interpretation

Variant confirmed as disease-causing by referring clinical team -

Apr 23, 2024

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: SPG7 c.1049_1077del29 (p.Pro350GlnfsX36) results in a premature termination codon, predicted to cause absence of the protein due to nonsense mediated decay, which is a commonly known mechanism for disease. The variant allele was found at a frequency of 1.6e-05 in 250546 control chromosomes (gnomAD). c.1049_1077del29 has been reported in the literature in an individual affected with Hereditary Spastic Paraplegia 7 (Klebe_2012). The following publication has been ascertained in the context of this evaluation (PMID: 23065789). ClinVar contains an entry for this variant (Variation ID: 495055). Based on the evidence outlined above, the variant was classified as pathogenic. -

Jan 01, 2022

PROSPAX: an integrated multimodal progression chart in spastic ataxias, Center for Neurology; Hertie-Institute for Clinical Brain Research

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

Mar 25, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Nov 15, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Pro350Glnfs*36) in the SPG7 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SPG7 are known to be pathogenic (PMID: 21623769, 22964162). This variant is present in population databases (rs775364547, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with hereditary spastic paraplegia (PMID: 23065789; internal data). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 495055). For these reasons, this variant has been classified as Pathogenic. -

Aug 07, 2017

Center of Genomic medicine, Geneva, University Hospital of Geneva

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This recessive SPG7 variant was found in compound heterozygosity with one another recessive SPG7 variant in a female patient with spastic paraplegia 7 -

-

Paris Brain Institute, Inserm - ICM

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:2

Jun 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

SPG7: PVS1, PM3:Strong, PM2 -

Aug 03, 2022

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at a significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 23065789, 32816195) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs775364547; hg19: chr16-89598368;