rs781901992

Variant names:

• chr12-6944186-CTAGTCAAGGCATAGGCTGCTGGCCTGGGG-C
• rs781901992
• NM_138425.4:c.52+26_52+54delAGGCTGCTGGCCTGGGGTAGTCAAGGCAT

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_138425.4(C12orf57):​c.52+26_52+54delAGGCTGCTGGCCTGGGGTAGTCAAGGCAT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0138 in 1,613,066 control chromosomes in the GnomAD database, including 172 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.010 (12 hom., cov: 33)
  • Exomes 𝑓: 0.014 (160 hom.)
• Consequence: C12orf57 NM_138425.4 intron
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 2.27
• Publications: 0 publications found

Genes affected

C12orf57 (HGNC:29521): (chromosome 12 open reading frame 57) This gene is ubiquitously expressed in human tissues. It is required for development of the human corpus callosum. Mutations in this gene are associated with Temtamy syndrome (TEMTYS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]

C12orf57 Gene-Disease associations (from GenCC):

• temtamy syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)

ENSG00000272173 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant 12-6944186-CTAGTCAAGGCATAGGCTGCTGGCCTGGGG-C is Benign according to our data. Variant chr12-6944186-CTAGTCAAGGCATAGGCTGCTGGCCTGGGG-C is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 210549.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.0103 (1569/152272) while in subpopulation NFE AF = 0.0155 (1054/68002). AF 95% confidence interval is 0.0147. There are 12 homozygotes in GnomAd4. There are 738 alleles in the male GnomAd4 subpopulation. Median coverage is 33. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 12 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
C12orf57	NM_138425.4	c.52+26_52+54delAGGCTGCTGGCCTGGGGTAGTCAAGGCAT		intron_variant	Intron 1 of 2	ENST00000229281.6	NP_612434.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
C12orf57	ENST00000229281.6	c.52+26_52+54delAGGCTGCTGGCCTGGGGTAGTCAAGGCAT		intron_variant	Intron 1 of 2	1	NM_138425.4	ENSP00000229281.5

Frequencies

GnomAD3 genomes AF: 0.0103 AC: 1569 AN: 152154 Hom.: 12 Cov.: 33

Gnomad AFR AF: 0.00302

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0102

Gnomad ASJ AF: 0.0228

Gnomad EAS AF: 0.00577

Gnomad SAS AF: 0.0134

Gnomad FIN AF: 0.00339

Gnomad MID AF: 0.00633

Gnomad NFE AF: 0.0155

Gnomad OTH AF: 0.0105

GnomAD2 exomes AF: 0.0114 AC: 2874 AN: 251392 AF XY: 0.0121

Gnomad AFR exome AF: 0.00234

Gnomad AMR exome AF: 0.00506

Gnomad ASJ exome AF: 0.0199

Gnomad EAS exome AF: 0.00598

Gnomad FIN exome AF: 0.00430

Gnomad NFE exome AF: 0.0153

Gnomad OTH exome AF: 0.0122

GnomAD4 exome AF: 0.0142 AC: 20701 AN: 1460794 Hom.: 160 AF XY: 0.0142 AC XY: 10292 AN XY: 726724

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00266 AC: 89 AN: 33474

American (AMR) AF: 0.00508 AC: 227 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.0217 AC: 567 AN: 26120

East Asian (EAS) AF: 0.00899 AC: 357 AN: 39694

South Asian (SAS) AF: 0.0133 AC: 1146 AN: 86246

European-Finnish (FIN) AF: 0.00449 AC: 240 AN: 53406

Middle Eastern (MID) AF: 0.00590 AC: 34 AN: 5766

European-Non Finnish (NFE) AF: 0.0156 AC: 17296 AN: 1110992

Other (OTH) AF: 0.0123 AC: 745 AN: 60372

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0103 AC: 1569 AN: 152272 Hom.: 12 Cov.: 33 AF XY: 0.00991 AC XY: 738 AN XY: 74478

African (AFR) AF: 0.00301 AC: 125 AN: 41558

American (AMR) AF: 0.0102 AC: 156 AN: 15290

Ashkenazi Jewish (ASJ) AF: 0.0228 AC: 79 AN: 3468

East Asian (EAS) AF: 0.00578 AC: 30 AN: 5186

South Asian (SAS) AF: 0.0132 AC: 64 AN: 4832

European-Finnish (FIN) AF: 0.00339 AC: 36 AN: 10618

Middle Eastern (MID) AF: 0.00680 AC: 2 AN: 294

European-Non Finnish (NFE) AF: 0.0155 AC: 1054 AN: 68002

Other (OTH) AF: 0.0109 AC: 23 AN: 2114

Alfa AF: 0.0115 Hom.: 2

Asia WGS AF: 0.0160 AC: 55 AN: 3478

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

Jun 29, 2015

Genetic Services Laboratory, University of Chicago

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Temtamy syndrome Benign:1

Feb 04, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.3
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs781901992; hg19: chr12-7053349;