rs786205054

Variant names:

• chr3-98592995-TACCTGTGCCAGAGCCTGGCAC-T
• rs786205054
• NM_000097.7:c.489_509delGTGCCAGGCTCTGGCACAGGT

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_000097.7(CPOX):​c.489_509delGTGCCAGGCTCTGGCACAGGT​(p.Cys164_Val170del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CPOX NM_000097.7 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 6.49
• Publications: 0 publications found

Genes affected

CPOX (HGNC:2321): (coproporphyrinogen oxidase) The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen III to protoporphyrinogen IX, a precursor of heme. Defects in this gene are a cause of hereditary coproporphyria (HCP).[provided by RefSeq, Oct 2009]

CPOX Gene-Disease associations (from GenCC):

• CPOX-related hereditary coproporphyria

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
• hereditary coproporphyria

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• harderoporphyria

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Genomics England PanelApp

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000097.7.
• PP5: Variant 3-98592995-TACCTGTGCCAGAGCCTGGCAC-T is Pathogenic according to our data. Variant chr3-98592995-TACCTGTGCCAGAGCCTGGCAC-T is described in ClinVar as Pathogenic. ClinVar VariationId is 455.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CPOX	NM_000097.7	c.489_509delGTGCCAGGCTCTGGCACAGGT	p.Cys164_Val170del	disruptive_inframe_deletion	Exon 1 of 7	ENST00000647941.2	NP_000088.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CPOX	ENST00000647941.2	c.489_509delGTGCCAGGCTCTGGCACAGGT	p.Cys164_Val170del	disruptive_inframe_deletion	Exon 1 of 7		NM_000097.7	ENSP00000497326.1
CPOX	ENST00000515041.1	n.595_615delGTGCCAGGCTCTGGCACAGGT		non_coding_transcript_exon_variant	Exon 1 of 3	2
CPOX	ENST00000513674.1	n.489_507+2delGTGCCAGGCTCTGGCACAGGT		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	Exon 1 of 4	5		ENSP00000424924.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Coproporphyria Pathogenic:1

Jan 01, 1997

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.5
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786205054; hg19: chr3-98311839;