rs786205054

Variant names:

• chr3-98592995-TACCTGTGCCAGAGCCTGGCAC-T
• rs786205054
• NM_000097.7:c.489_509delGTGCCAGGCTCTGGCACAGGT

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_000097.7(CPOX):​c.489_509delGTGCCAGGCTCTGGCACAGGT​(p.Cys164_Val170del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CPOX NM_000097.7 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 6.49
• Publications: 0 publications found

Genes affected

CPOX (HGNC:2321): (coproporphyrinogen oxidase) The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen III to protoporphyrinogen IX, a precursor of heme. Defects in this gene are a cause of hereditary coproporphyria (HCP).[provided by RefSeq, Oct 2009]

CPOX Gene-Disease associations (from GenCC):

• CPOX-related hereditary coproporphyria

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
• harderoporphyria

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Genomics England PanelApp
• hereditary coproporphyria

  Inheritance: AR, AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000097.7.
• PP5: Variant 3-98592995-TACCTGTGCCAGAGCCTGGCAC-T is Pathogenic according to our data. Variant chr3-98592995-TACCTGTGCCAGAGCCTGGCAC-T is described in ClinVar as Pathogenic. ClinVar VariationId is 455.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000097.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CPOX	NM_000097.7	MANE Select	c.489_509delGTGCCAGGCTCTGGCACAGGT	p.Cys164_Val170del	disruptive_inframe_deletion	Exon 1 of 7	NP_000088.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CPOX	ENST00000647941.2	MANE Select	c.489_509delGTGCCAGGCTCTGGCACAGGT	p.Cys164_Val170del	disruptive_inframe_deletion	Exon 1 of 7	ENSP00000497326.1	P36551-1
	CPOX	ENST00000946176.1		c.489_509delGTGCCAGGCTCTGGCACAGGT	p.Cys164_Val170del	disruptive_inframe_deletion	Exon 1 of 8	ENSP00000616235.1
	CPOX	ENST00000932270.1		c.489_509delGTGCCAGGCTCTGGCACAGGT	p.Cys164_Val170del	disruptive_inframe_deletion	Exon 1 of 7	ENSP00000602329.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Coproporphyria (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.5
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786205054; hg19: chr3-98311839;