Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_007294.4(BRCA1):c.3705_3747dupCAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACC(p.Glu1250GlnfsTer8) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. T1249T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]
BRCA1 Gene-Disease associations (from GenCC):
breast-ovarian cancer, familial, susceptibility to, 1
Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
Our verdict: Pathogenic. The variant received 16 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 17-43091783-C-CGGTAGCAACGGTGCTATGCCTAGTAGACTGAGAAGGTATATTG is Pathogenic according to our data. Variant chr17-43091783-C-CGGTAGCAACGGTGCTATGCCTAGTAGACTGAGAAGGTATATTG is described in ClinVar as Pathogenic. ClinVar VariationId is 440468.Status of the report is reviewed_by_expert_panel, 3 stars.
Breast-ovarian cancer, familial, susceptibility to, 1Pathogenic:2
Dec 15, 2017
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)
Significance:Pathogenic
Review Status:reviewed by expert panel
Collection Method:curation
Variant allele predicted to encode a truncated non-functional protein. -
Nov 09, 2023
All of Us Research Program, National Institutes of Health
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing
The c.3705_3747dup (p.Glu1250Glnfs*8) variant of the BRCA1 gene creates an premature translation termination codon. It is predicted to result in an absent or disrupted protein product. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). ClinVar has an entry for this variant and it has been classified as pathogenic by the expert panel (ID: 440468). Truncating variants in BRCA1 gene are known to be pathogenic (PMID: 21989022, 17661172, 22762150). Therefore the c.3705_3747dup (p.Glu1250Glnfs*8) variant of the BRCA1 gene is classified as pathogenic. -
not providedPathogenic:2
Jan 25, 2018
Eurofins Ntd Llc (ga)
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing
- -
Jul 18, 2016
Quest Diagnostics Nichols Institute San Juan Capistrano
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing
- -
Hereditary breast ovarian cancer syndromePathogenic:2
Aug 02, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing
This sequence change creates a premature translational stop signal (p.Glu1250Glnfs*8) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with BRCA1-related conditions. ClinVar contains an entry for this variant (Variation ID: 440468). For these reasons, this variant has been classified as Pathogenic. -
Jan 04, 2016
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing
Variant summary: This c.3705_3747dup43 variant causes a frameshift, which alters the proteins amino acid sequence beginning at position 1250 and leads to a premature termination codon 8 amino acids downstream. It is predicted to cause a truncated or absent BRCA1 protein. Heterozygous loss-of-function due to mutations in this gene is an established disease mechanism in HBOC. Truncations downstream of this position have been classified as pathogenic by our laboratory (e.g. p.Glu1257fs). This variant was not found in approximately 121390 chromosomes from broad and large populations from ExAC. To our knowledge, this variant has not been reported in affected individuals via publications and/or reputable databases/clinical laboratories. Taken together, this variant has currently been classified as Likely Pathogenic. -
The c.3705_3747dup43 pathogenic mutation, located in coding exon 9 of the BRCA1 gene, results from a duplication of CAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACC at nucleotide position 3705, causing a translational frameshift with a predicted alternate stop codon (p.E1250Qfs*8). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -