rs797044631

chr17-43091783-C-CGGTAGCAACGGTGCTATGCCTAGTAGACTGAGAAGGTATATTG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_007294.4(BRCA1):c.3747_3748insCAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACC(p.Glu1250GlnfsTer8) variant causes a stop gained, frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. T1249T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: BRCA1 NM_007294.4 stop_gained, frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:7
• Conservation: PhyloP100: -0.453

Genes affected

BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-43091783-C-CGGTAGCAACGGTGCTATGCCTAGTAGACTGAGAAGGTATATTG is Pathogenic according to our data. Variant chr17-43091783-C-CGGTAGCAACGGTGCTATGCCTAGTAGACTGAGAAGGTATATTG is described in ClinVar as [Pathogenic]. Clinvar id is 440468.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
BRCA1	NM_007294.4	c.3747_3748insCAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACC	p.Glu1250GlnfsTer8	stop_gained, frameshift_variant	10/23	ENST00000357654.9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
BRCA1	ENST00000357654.9	c.3747_3748insCAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACC	p.Glu1250GlnfsTer8	stop_gained, frameshift_variant	10/23	1	NM_007294.4	P4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:7

Revision: reviewed by expert panel

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 1 Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	All of Us Research Program, National Institutes of Health	Nov 09, 2023	The c.3705_3747dup (p.Glu1250Glnfs*8) variant of the BRCA1 gene creates an premature translation termination codon. It is predicted to result in an absent or disrupted protein product. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). ClinVar has an entry for this variant and it has been classified as pathogenic by the expert panel (ID: 440468). Truncating variants in BRCA1 gene are known to be pathogenic (PMID: 21989022, 17661172, 22762150). Therefore the c.3705_3747dup (p.Glu1250Glnfs*8) variant of the BRCA1 gene is classified as pathogenic. -
Pathogenic, reviewed by expert panel	curation	Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)	Dec 15, 2017	Variant allele predicted to encode a truncated non-functional protein. -

not provided Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Quest Diagnostics Nichols Institute San Juan Capistrano	Jul 18, 2016	- -
Pathogenic, criteria provided, single submitter	clinical testing	Eurofins Ntd Llc (ga)	Jan 25, 2018	- -

Hereditary breast ovarian cancer syndrome Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Invitae	Aug 02, 2023	For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 440468). This variant has not been reported in the literature in individuals affected with BRCA1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Glu1250Glnfs*8) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). -
Likely pathogenic, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Jan 04, 2016	Variant summary: This c.3705_3747dup43 variant causes a frameshift, which alters the proteins amino acid sequence beginning at position 1250 and leads to a premature termination codon 8 amino acids downstream. It is predicted to cause a truncated or absent BRCA1 protein. Heterozygous loss-of-function due to mutations in this gene is an established disease mechanism in HBOC. Truncations downstream of this position have been classified as pathogenic by our laboratory (e.g. p.Glu1257fs). This variant was not found in approximately 121390 chromosomes from broad and large populations from ExAC. To our knowledge, this variant has not been reported in affected individuals via publications and/or reputable databases/clinical laboratories. Taken together, this variant has currently been classified as Likely Pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

May 04, 2020

The c.3705_3747dup43 pathogenic mutation, located in coding exon 9 of the BRCA1 gene, results from a duplication of CAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACC at nucleotide position 3705, causing a translational frameshift with a predicted alternate stop codon (p.E1250Qfs*8). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs797044631; hg19: chr17-41243800;