rs797045500
Variant names:
Your query was ambiguous. Multiple possible variants found:
Variant summary
Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PVS1_StrongPM2PP5
The NM_004380.3(CREBBP):c.6395_6417delGCATGCACCAGCAGCCCAGCCTG(p.Gly2132AlafsTer201) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Genomes: not found (cov: 32)
Consequence
CREBBP
NM_004380.3 frameshift
NM_004380.3 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 7.34
Genes affected
CREBBP (HGNC:2348): (CREB binding protein) This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 7 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.127 CDS is truncated, and there are 3 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 16-3728629-GCAGGCTGGGCTGCTGGTGCATGC-G is Pathogenic according to our data. Variant chr16-3728629-GCAGGCTGGGCTGCTGGTGCATGC-G is described in ClinVar as [Pathogenic]. Clinvar id is 694795.Status of the report is no_assertion_criteria_provided, 0 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CREBBP | NM_004380.3 | c.6395_6417delGCATGCACCAGCAGCCCAGCCTG | p.Gly2132AlafsTer201 | frameshift_variant | Exon 31 of 31 | ENST00000262367.10 | NP_004371.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CREBBP | ENST00000262367.10 | c.6395_6417delGCATGCACCAGCAGCCCAGCCTG | p.Gly2132AlafsTer201 | frameshift_variant | Exon 31 of 31 | 1 | NM_004380.3 | ENSP00000262367.5 | ||
CREBBP | ENST00000382070.7 | c.6281_6303delGCATGCACCAGCAGCCCAGCCTG | p.Gly2094AlafsTer201 | frameshift_variant | Exon 30 of 30 | 1 | ENSP00000371502.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link
Submissions by phenotype
Rubinstein-Taybi syndrome due to CREBBP mutations Pathogenic:1
Nov 05, 2019
Wessex Regional Genetics Laboratory, Salisbury District Hospital
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: clinical testing
- -
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at