rs80359875

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_007294.4(BRCA1):​c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA​(p.Asn363SerfsTer2) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

BRCA1
NM_007294.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic reviewed by expert panel P:10

Conservation

PhyloP100: 5.76
Variant links:
Genes affected
BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 17-43094389-TTCTGAATGCTGCTATTTAGTGTTATCCAAGGAACATCTTCAGTATCTCTAGGATTC-T is Pathogenic according to our data. Variant chr17-43094389-TTCTGAATGCTGCTATTTAGTGTTATCCAAGGAACATCTTCAGTATCTCTAGGATTC-T is described in ClinVar as [Pathogenic]. Clinvar id is 91539.Status of the report is reviewed_by_expert_panel, 3 stars. Variant chr17-43094389-TTCTGAATGCTGCTATTTAGTGTTATCCAAGGAACATCTTCAGTATCTCTAGGATTC-T is described in Lovd as [Pathogenic]. Variant chr17-43094389-TTCTGAATGCTGCTATTTAGTGTTATCCAAGGAACATCTTCAGTATCTCTAGGATTC-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRCA1NM_007294.4 linkc.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA p.Asn363SerfsTer2 frameshift_variant Exon 10 of 23 ENST00000357654.9 NP_009225.1 P38398-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRCA1ENST00000357654.9 linkc.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA p.Asn363SerfsTer2 frameshift_variant Exon 10 of 23 1 NM_007294.4 ENSP00000350283.3 P38398-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:10
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 1 Pathogenic:5
May 29, 2002
Breast Cancer Information Core (BIC) (BRCA1)
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: clinical testing

- -

Sep 08, 2016
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)
Significance: Pathogenic
Review Status: reviewed by expert panel
Collection Method: curation

Variant allele predicted to encode a truncated non-functional protein. -

Oct 06, 2012
Sharing Clinical Reports Project (SCRP)
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: clinical testing

- -

Oct 02, 2015
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Jan 12, 2023
Baylor Genetics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Hereditary breast ovarian cancer syndrome Pathogenic:3
Jul 01, 2021
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

Variant summary: BRCA1 c.1086_1141del56 (p.Asn363SerfsX2) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant was absent in 251160 control chromosomes. c.1086_1141del56 has been reported in the literature and databases in individuals affected with Hereditary Breast And Ovarian Cancer Syndrome (Weitzel_2005). To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Four clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Jan 31, 2014
Research Molecular Genetics Laboratory, Women's College Hospital, University of Toronto
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: research

- -

Jun 21, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Asn363Serfs*2) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with a personal or family history of breast and/or ovarian cancer (PMID: 12879478, 16030099). This variant is also known as 1205del56. ClinVar contains an entry for this variant (Variation ID: 91539). For these reasons, this variant has been classified as Pathogenic. -

not provided Pathogenic:1
Aug 23, 2022
Quest Diagnostics Nichols Institute San Juan Capistrano
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This frameshift variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. This variant has not been reported in large, multi-ethnic general populations (http://gnomad.broadinstitute.org). In the published literature, the variant has been reported in Mexican or Hispanic individuals/families with breast cancer in the published literature (PMIDs: 16030099 (2005) and 12879478 (2003)). Based on the available information, this variant is classified as pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1
Jul 16, 2024
Ambry Genetics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.1086_1141del56 pathogenic mutation, located in coding exon 9 of the BRCA1 gene, results from a deletion of 56 nucleotides at nucleotide positions 1086 to 1141, causing a translational frameshift with a predicted alternate stop codon (p.N363Sfs*2). This mutation, also known as 1205del56 in the literature, has been reported in multiple unrelated hereditary breast and ovarian cancer families of Mexican/Hispanic ancestry and is considered to be a founder mutation in this population (Mullineaux LG et al. Cancer 2003 Aug;98(3):597-602; Weitzel JN et al. Cancer Epidemiol. Biomarkers Prev. 2005 Jul;14(7):1666-71; Torres-Mejía G et al. Cancer Epidemiol Biomarkers Prev. 2014 Nov 4). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs80359875; hg19: chr17-41246406; API