rs863225412

Variant names:

• chr2-47806296-ACTCACTACCATTCATTAGTAGAAGATTATT-A
• rs863225412
• NM_000179.3:c.3744_3773delCTACCATTCATTAGTAGAAGATTATTCTCA

Variant summary

Our verdict is Pathogenic. The variant received 17 ACMG points: 17P and 0B. PS3 PM1 PM4 PP3 PP5_Very_Strong

The NM_000179.3(MSH6):​c.3744_3773delCTACCATTCATTAGTAGAAGATTATTCTCA​(p.His1248_Ser1257del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,168 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV000580154: Based on internal structural analysis, this alteration results in a distortion of the α-helix of a protein-protein interface of MSH6, significantly altering the surrounding residues (Warren JJ et al. Mol. Cell. 2007 May" and additional evidence is available in ClinVar. Synonymous variant affecting the same amino acid position (i.e. H1248H) has been classified as Likely benign. The gene MSH6 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
• Consequence: MSH6 NM_000179.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:8 U:1 O:1
• Conservation: PhyloP100: 8.85
• Publications: 2 publications found

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

FBXO11 Gene-Disease associations (from GenCC):

• intellectual developmental disorder with dysmorphic facies and behavioral abnormalities

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)

ACMG classification

Specifications for MSH6 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Pathogenic. The variant received 17 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV000580154: Based on internal structural analysis, this alteration results in a distortion of the α-helix of a protein-protein interface of MSH6, significantly altering the surrounding residues (Warren JJ et al. Mol. Cell. 2007 May; 26(4):579-92).
• PM1: In a hotspot region, there are 7 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 4 benign, 48 uncertain in NM_000179.3
• PM4: Nonframeshift variant in NON repetitive region in NM_000179.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-47806296-ACTCACTACCATTCATTAGTAGAAGATTATT-A is Pathogenic according to our data. Variant chr2-47806296-ACTCACTACCATTCATTAGTAGAAGATTATT-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 218070.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000179.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	NM_000179.3	MANE Select	c.3744_3773delCTACCATTCATTAGTAGAAGATTATTCTCA	p.His1248_Ser1257del	disruptive_inframe_deletion	Exon 8 of 10	NP_000170.1	P52701-1
	MSH6	NM_001406795.1		c.3840_3869delCTACCATTCATTAGTAGAAGATTATTCTCA	p.His1280_Ser1289del	disruptive_inframe_deletion	Exon 9 of 11	NP_001393724.1
	MSH6	NM_001406813.1		c.3750_3779delCTACCATTCATTAGTAGAAGATTATTCTCA	p.His1250_Ser1259del	disruptive_inframe_deletion	Exon 8 of 10	NP_001393742.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	ENST00000234420.11	TSL:1 MANE Select	c.3744_3773delCTACCATTCATTAGTAGAAGATTATTCTCA	p.His1248_Ser1257del	disruptive_inframe_deletion	Exon 8 of 10	ENSP00000234420.5	P52701-1
	MSH6	ENST00000445503.5	TSL:1	n.*3091_*3120delCTACCATTCATTAGTAGAAGATTATTCTCA		non_coding_transcript_exon	Exon 7 of 9	ENSP00000405294.1	F8WAX8
	MSH6	ENST00000445503.5	TSL:1	n.*3091_*3120delCTACCATTCATTAGTAGAAGATTATTCTCA		3_prime_UTR	Exon 7 of 9	ENSP00000405294.1	F8WAX8

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152168 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251206 AF XY: 0.00000737

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000881

Gnomad OTH exome AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152168 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74344

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41438

American (AMR) AF: 0.00 AC: 0 AN: 15278

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5200

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10598

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68028

Other (OTH) AF: 0.00 AC: 0 AN: 2094

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Hereditary cancer-predisposing syndrome (2)
2	-	-	not provided (2)
1	-	-	Endometrial carcinoma (1)
1	-	-	Hereditary nonpolyposis colon cancer (1)
1	-	-	Hereditary nonpolyposis colorectal neoplasms (1)
1	-	-	Lynch syndrome (1)
-	1	-	not specified (1)
-	-	-	Lynch syndrome 5;C5399763:Mismatch repair cancer syndrome 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.9
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs863225412; hg19: chr2-48033435;