rs863225412

Variant names:

• chr2-47806296-ACTCACTACCATTCATTAGTAGAAGATTATT-A
• rs863225412
• NM_000179.3:c.3744_3773delCTACCATTCATTAGTAGAAGATTATTCTCA

Variant summary

Our verdict is Pathogenic. Variant got 13 ACMG points: 13P and 0B. PM2 PM4 PP3 PP5_Very_Strong

The NM_000179.3(MSH6):​c.3744_3773delCTACCATTCATTAGTAGAAGATTATTCTCA​(p.His1248_Ser1257del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,168 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
• Consequence: MSH6 NM_000179.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:7 U:1
• Conservation: PhyloP100: 8.85

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

ACMG classification

Verdict is Pathogenic. Variant got 13 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000179.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-47806296-ACTCACTACCATTCATTAGTAGAAGATTATT-A is Pathogenic according to our data. Variant chr2-47806296-ACTCACTACCATTCATTAGTAGAAGATTATT-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 218070.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MSH6	NM_000179.3	c.3744_3773delCTACCATTCATTAGTAGAAGATTATTCTCA	p.His1248_Ser1257del	disruptive_inframe_deletion	Exon 8 of 10	ENST00000234420.11	NP_000170.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MSH6	ENST00000234420.11	c.3744_3773delCTACCATTCATTAGTAGAAGATTATTCTCA	p.His1248_Ser1257del	disruptive_inframe_deletion	Exon 8 of 10	1	NM_000179.3	ENSP00000234420.5

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152168 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.00000398 AC: 1 AN: 251206 Hom.: 0 AF XY: 0.00000737 AC XY: 1 AN XY: 135758

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000881

Gnomad OTH exome AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152168 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74344

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000147

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:7 Uncertain:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:2

Jan 21, 2022

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3744_3773del30 pathogenic mutation (also known as p.H1248_S1257del) is located in coding exon 8 of the MSH6 gene. This mutation results from an in-frame deletion of 30 nucleotides at positions 3744 to 3773 and causes the removal of 10 well-conserved amino acid residues at codons 1248 to 1257. This mutation has been seen in individuals with Lynch syndrome, including three families meeting Amsterdam criteria with tumor results from one family showing loss of MSH6 protein on immunohistochemistry (Chang K et al. JAMA Oncol, 2018 08;4:1085-1092; Ambry internal data). This mutation was also reported in a woman whose endometrial tumor demonstrated loss of MSH6 on IHC (Dedeurwaerdere F et al. Sci Rep, 2021 06;11:12880). In addition, this mutation segregated with disease in the three families with a combined LOD score of 1.8 (Ambry internal data). Based on internal structural analysis, this alteration results in a distortion of the α-helix of a protein-protein interface of MSH6, significantly altering the surrounding residues (Warren JJ et al. Mol. Cell. 2007 May; 26(4):579-92). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. -

Jun 08, 2023

Color Diagnostics, LLC DBA Color Health

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant causes an in-frame deletion of 10 amino acids at exon 8 of the MSH6 protein. To our knowledge, functional studies have not been reported for this variant. This variant has been reported in individuals affected with Lynch syndrome and Lynch syndrome-associated cancer (PMID: 29710228; ClinVar SCV000580154.5, SCV000624910.8), and in an individual affected with mismatch repair deficient endometrial cancer (PMID: 34145315).This variant has been identified in 1/251206 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Based on the available evidence, this variant is classified as Likely Pathogenic. -

Hereditary nonpolyposis colon cancer Pathogenic:1

Dec 20, 2024

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: MSH6 c.3744_3773del30 (p.His1248_Ser1257del) results in an in-frame deletion that is predicted to remove 10 amino acids from the DNA mismatch repair protein MutS, C-terminal domain of the encoded protein. The variant allele was found at a frequency of 4e-06 in 251206 control chromosomes. c.3744_3773del30 has been reported in the literature in multiple individuals affected with features of Lynch Syndrome/Hereditary Nonpolyposis Colorectal Cancer (example, Chang_2018, Dedeurwaerdere_2021, personal correspondance from our partner laboratory). These data indicate that the variant is very likely to be associated with disease. At-least one co-occurrence with another pathogenic variant has been observed at our laboratory (APC c.487C>T, p.Gln163X). To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 29710228, 34145315, 29922827). ClinVar contains an entry for this variant (Variation ID: 218070). Based on the evidence outlined above, the variant was classified as pathogenic. -

Lynch syndrome Pathogenic:1

Aug 15, 2023

All of Us Research Program, National Institutes of Health

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant causes an in-frame deletion of 10 amino acids at exon 8 of the MSH6 protein. To our knowledge, functional studies have not been reported for this variant. This variant has been reported in individuals affected with Lynch syndrome and Lynch syndrome-associated cancer (PMID: 29710228; ClinVar SCV000580154.5, SCV000624910.8), and in an individual affected with mismatch repair deficient endometrial cancer (PMID: 34145315).This variant has been identified in 1/251206 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Based on the available evidence, this variant is classified as Likely Pathogenic. -

not provided Pathogenic:1

Sep 01, 2022

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame deletion of 10 amino acids in a non-repeat region predicted to critically alter the protein: disrupts the ATPase domain (Warren et al., 2007, Kansikas et al., 2011); In silico analysis supports a deleterious effect on protein structure/function; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 28765196, 25504618, 29922827, 17531815, 21120944, 34145315) -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Oct 10, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.3744_3773del, results in the deletion of 10 amino acid(s) of the MSH6 protein (p.His1248_Ser1257del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.0009%). This variant has been observed in individuals with Lynch syndrome-related cancers and Lynch syndrome (External communication, internal data). It has also been observed to segregate with disease in related individuals. Invitae Evidence Modeling of clinical and family history, age, sex, and reported ancestry of multiple individuals with this MSH6 variant has been performed. This variant is expected to be pathogenic with a positive predictive value of at least 99%. This is a validated machine learning model that incorporates the clinical features of 1,370,736 individuals referred to our laboratory for MSH6 testing. ClinVar contains an entry for this variant (Variation ID: 218070). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. For these reasons, this variant has been classified as Pathogenic. -

Endometrial carcinoma Pathogenic:1

Jan 20, 2024

Baylor Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not specified Uncertain:1

-

Mayo Clinic Laboratories, Mayo Clinic

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs863225412; hg19: chr2-48033435;