rs878853630

Positions:

• chr11-2884908-TGGAGCCGGGGCCGGAGCCGGAGCC-T
• chr11-2884908-TGGAGCCGGGGCCGGAGCCGGAGCC-TGGAGCCGGGGCCGGAGCCGGAGCCGGAGCCGGGGCCGGAGCCGGAGCC

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP6 BS2

The NM_001122630.2(CDKN1C):​c.525_548delGGCTCCGGCTCCGGCCCCGGCTCC​(p.Ala176_Pro183del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000222 in 770,090 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00028 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00021 (0 hom.)
• Consequence: CDKN1C NM_001122630.2 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:3
• Conservation: PhyloP100: 1.37

Genes affected

CDKN1C (HGNC:1786): (cyclin dependent kinase inhibitor 1C) This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]

CDKN1C (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP6: Variant 11-2884908-TGGAGCCGGGGCCGGAGCCGGAGCC-T is Benign according to our data. Variant chr11-2884908-TGGAGCCGGGGCCGGAGCCGGAGCC-T is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 236956.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=3, Uncertain_significance=1}.
• BS2: High AC in GnomAd4 at 33 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CDKN1C	NM_001122630.2	c.525_548delGGCTCCGGCTCCGGCCCCGGCTCC	p.Ala176_Pro183del	disruptive_inframe_deletion	2/4	ENST00000440480.8	NP_001116102.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CDKN1C	ENST00000440480.8	c.525_548delGGCTCCGGCTCCGGCCCCGGCTCC	p.Ala176_Pro183del	disruptive_inframe_deletion	2/4	1	NM_001122630.2	ENSP00000411257.2

Frequencies

GnomAD3 genomes AF: 0.000274 AC: 32 AN: 116966 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000132

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000398

Gnomad ASJ AF: 0.00138

Gnomad EAS AF: 0.000259

Gnomad SAS AF: 0.000282

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000309

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000211 AC: 138 AN: 653046 Hom.: 0 AF XY: 0.000227 AC XY: 70 AN XY: 308004

Gnomad4 AFR exome AF: 0.000163

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.000542

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000768

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000194

Gnomad4 OTH exome AF: 0.000432

GnomAD4 genome AF: 0.000282 AC: 33 AN: 117044 Hom.: 0 Cov.: 32 AF XY: 0.000314 AC XY: 18 AN XY: 57292

Gnomad4 AFR AF: 0.000131

Gnomad4 AMR AF: 0.000398

Gnomad4 ASJ AF: 0.00138

Gnomad4 EAS AF: 0.000260

Gnomad4 SAS AF: 0.000567

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000309

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000169 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:3

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Beckwith-Wiedemann syndrome Uncertain:1 Benign:1

Likely benign, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 24, 2024	- -
Uncertain significance, criteria provided, single submitter	curation	Sema4, Sema4	Jun 09, 2021	- -

Inborn genetic diseases Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Ambry Genetics

May 13, 2022

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

not provided Benign:1

Likely benign, criteria provided, single submitter

clinical testing

CeGaT Center for Human Genetics Tuebingen

Feb 01, 2024

CDKN1C: BS1 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs878853630; hg19: chr11-2906138;