rs878853638

chr11-2884840-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG-Tchr11-2884840-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG-TCCGGGGchr11-2884840-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGGCCGGGGCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGGchr11-2884840-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM1

The NM_001122630.2(CDKN1C):c.581_616del(p.Ala194_Pro205del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. A194A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CDKN1C NM_001122630.2 inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.949

Genes affected

CDKN1C (HGNC:1786): (cyclin dependent kinase inhibitor 1C) This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 16 uncertain in NM_001122630.2

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
CDKN1C	NM_001122630.2	c.581_616del	p.Ala194_Pro205del	inframe_deletion	2/4	ENST00000440480.8

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
CDKN1C	ENST00000440480.8	c.581_616del	p.Ala194_Pro205del	inframe_deletion	2/4	1	NM_001122630.2	A2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 994084 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 475932

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs878853638; hg19: chr11-2906070;