rs878853638
- chr11-2884840-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG-T
- chr11-2884840-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG-TCCGGGG
- chr11-2884840-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGGCCGGGGCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG
- chr11-2884840-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGGCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG
- chr11-2884840-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001122630.2(CDKN1C):c.581_616delCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG(p.Ala194_Pro205del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. A194A) has been classified as Likely benign.
Frequency
Consequence
NM_001122630.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Beckwith-Wiedemann syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- IMAGe syndromeInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Illumina, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Orphanet
- rhabdomyosarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- Beckwith-Wiedemann syndrome due to CDKN1C mutationInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- intrauterine growth restriction-short stature-early adult-onset diabetes syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Silver-Russell syndromeInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001122630.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDKN1C | MANE Select | c.581_616delCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG | p.Ala194_Pro205del | disruptive_inframe_deletion | Exon 2 of 4 | NP_001116102.1 | P49918-2 | ||
| CDKN1C | c.614_649delCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG | p.Ala205_Pro216del | disruptive_inframe_deletion | Exon 1 of 3 | NP_000067.1 | P49918-1 | |||
| CDKN1C | c.614_649delCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG | p.Ala205_Pro216del | disruptive_inframe_deletion | Exon 1 of 3 | NP_001349403.1 | P49918-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDKN1C | TSL:1 MANE Select | c.581_616delCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG | p.Ala194_Pro205del | disruptive_inframe_deletion | Exon 2 of 4 | ENSP00000411257.2 | P49918-2 | ||
| CDKN1C | TSL:1 | c.614_649delCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG | p.Ala205_Pro216del | disruptive_inframe_deletion | Exon 1 of 3 | ENSP00000413720.3 | P49918-1 | ||
| CDKN1C | TSL:1 | c.614_649delCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG | p.Ala205_Pro216del | disruptive_inframe_deletion | Exon 1 of 3 | ENSP00000411552.2 | P49918-1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0AN: 994084Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 475932
GnomAD4 genome Cov.: 33
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.