rs878853742

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_001406800.1(MSH6):​c.3917_3957dupGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG​(p.Arg1320fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

MSH6
NM_001406800.1 frameshift, stop_gained

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3

Conservation

PhyloP100: 0.672
Variant links:
Genes affected
MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-47806579-A-AGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG is Pathogenic according to our data. Variant chr2-47806579-A-AGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 237202.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
MSH6NM_000179.3 linkuse as main transcriptc.3930_3970dupGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG p.Glu1324fs frameshift_variant 9/10 ENST00000234420.11 NP_000170.1 P52701-1Q3SWU9

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
MSH6ENST00000234420.11 linkuse as main transcriptc.3930_3970dupGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG p.Glu1324fs frameshift_variant 9/101 NM_000179.3 ENSP00000234420.5 P52701-1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
35
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Lynch syndrome 5 Pathogenic:1
Likely pathogenic, criteria provided, single submitterclinical testingMyriad Genetics, Inc.Aug 28, 2023This variant is considered likely pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpDec 20, 2020For these reasons, this variant has been classified as Pathogenic. This variant disrupts the C-terminus of the MSH6 protein. Other variant(s) that disrupt this region (p.Leu1330Valfs*12) have been determined to be pathogenic (PMID: 14520694, 15236168, 16237223, 19851887, 21155762). This suggests that variants that disrupt this region of the protein are likely to be causative of disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acid(s) is currently unknown. This variant has not been reported in the literature in individuals with MSH6-related conditions. ClinVar contains an entry for this variant (Variation ID: 237202). This sequence change results in a premature translational stop signal in the MSH6 gene (p.Glu1324Glyfs*17). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 37 amino acids of the MSH6 protein. -
Hereditary cancer-predisposing syndrome Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingAmbry GeneticsDec 08, 2023The c.3930_3970dup41 variant, located in coding exon 9 of the MSH6 gene, results from a duplication of 41 nucleotides at positions 3930 to 3970, causing a translational frameshift with a predicted alternate stop codon (p.E1324Gfs*17). This alteration occurs at the 3' terminus of theMSH6 gene, is not expected to trigger nonsense-mediated mRNA decay, and only impacts the last 2.4% of the protein. However, premature stop codons are typically deleterious in nature and the impacted region is critical for protein function (Ambry internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs878853742; hg19: chr2-48033718; API