rs878853742

Variant names:

• chr2-47806579-A-AGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG
• rs878853742
• NM_000179.3:c.3930_3970dupGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG

Variant summary

Our verdict is Pathogenic. The variant received 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_001406800.1(MSH6):​c.3917_3957dupGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG​(p.Arg1320GlyfsTer8) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. R1320R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MSH6 NM_001406800.1 frameshift, stop_gained
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 0.672

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

ACMG classification

Our verdict: Pathogenic. The variant received 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-47806579-A-AGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG is Pathogenic according to our data. Variant chr2-47806579-A-AGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 237202.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MSH6	NM_000179.3	c.3930_3970dupGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG	p.Glu1324GlyfsTer17	frameshift_variant	Exon 9 of 10	ENST00000234420.11	NP_000170.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MSH6	ENST00000234420.11	c.3930_3970dupGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG	p.Glu1324GlyfsTer17	frameshift_variant	Exon 9 of 10	1	NM_000179.3	ENSP00000234420.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Lynch syndrome 5 Pathogenic:1

Aug 28, 2023

Myriad Genetics, Inc.

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Dec 12, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Glu1324Glyfs*17) in the MSH6 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 37 amino acid(s) of the MSH6 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. ClinVar contains an entry for this variant (Variation ID: 237202). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts a region of the MSH6 protein in which other variant(s) (p.Leu1330Valfs*12) have been determined to be pathogenic (PMID: 14520694, 15236168, 16237223, 19851887, 21155762). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1

Dec 08, 2023

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3930_3970dup41 variant, located in coding exon 9 of the MSH6 gene, results from a duplication of 41 nucleotides at positions 3930 to 3970, causing a translational frameshift with a predicted alternate stop codon (p.E1324Gfs*17). This alteration occurs at the 3' terminus of theMSH6 gene, is not expected to trigger nonsense-mediated mRNA decay, and only impacts the last 2.4% of the protein. However, premature stop codons are typically deleterious in nature and the impacted region is critical for protein function (Ambry internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
Mutation Taster		=3/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs878853742; hg19: chr2-48033718;