rs879254620

Variant names:

• chr19-11105565-C-CCGACTGCAAGGACAAATCTGA
• rs879254620
• NM_000527.5:c.663_683dupCTGCAAGGACAAATCTGACGA

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PM1 PM4 PP5_Very_Strong

The NM_000527.5(LDLR):​c.663_683dupCTGCAAGGACAAATCTGACGA​(p.Asp221_Asp227dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000131 in 152,188 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. E228E) has been classified as Likely benign.

• Frequency: Genomes: 𝑓 0.000013 (0 hom., cov: 33)
• Consequence: LDLR NM_000527.5 disruptive_inframe_insertion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: -8.36
• Publications: 1 publications found

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

LDLR Gene-Disease associations (from GenCC):

• hypercholesterolemia, familial, 1

  Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen
• homozygous familial hypercholesterolemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PM1: In a hotspot region, there are 42 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 13 uncertain in NM_000527.5
• PM4: Nonframeshift variant in NON repetitive region in NM_000527.5.
• PP5: Variant 19-11105565-C-CCGACTGCAAGGACAAATCTGA is Pathogenic according to our data. Variant chr19-11105565-C-CCGACTGCAAGGACAAATCTGA is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 251358.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000527.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	NM_000527.5	MANE Select	c.663_683dupCTGCAAGGACAAATCTGACGA	p.Asp221_Asp227dup	disruptive_inframe_insertion	Exon 4 of 18	NP_000518.1	P01130-1
	LDLR	NM_001195798.2		c.663_683dupCTGCAAGGACAAATCTGACGA	p.Asp221_Asp227dup	disruptive_inframe_insertion	Exon 4 of 18	NP_001182727.1	P01130-5
	LDLR	NM_001195799.2		c.540_560dupCTGCAAGGACAAATCTGACGA	p.Asp180_Asp186dup	disruptive_inframe_insertion	Exon 3 of 17	NP_001182728.1	P01130-4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	ENST00000558518.6	TSL:1 MANE Select	c.663_683dupCTGCAAGGACAAATCTGACGA	p.Asp221_Asp227dup	disruptive_inframe_insertion	Exon 4 of 18	ENSP00000454071.1	P01130-1
	LDLR	ENST00000252444.10	TSL:1	c.921_941dupCTGCAAGGACAAATCTGACGA	p.Asp307_Asp313dup	disruptive_inframe_insertion	Exon 4 of 18	ENSP00000252444.6	J3KMZ9
	LDLR	ENST00000558013.5	TSL:1	c.663_683dupCTGCAAGGACAAATCTGACGA	p.Asp221_Asp227dup	disruptive_inframe_insertion	Exon 4 of 18	ENSP00000453346.1	P01130-5

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152188 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000483

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 33

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152188 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74342

African (AFR) AF: 0.0000483 AC: 2 AN: 41446

American (AMR) AF: 0.00 AC: 0 AN: 15266

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5198

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10618

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68038

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
4	-	-	Hypercholesterolemia, familial, 1 (4)
2	-	-	Familial hypercholesterolemia (2)
2	-	-	not provided (2)
1	-	-	Cardiovascular phenotype (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-8.4
Mutation Taster		=61/39	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs879254620; hg19: chr19-11216241;