rs886038633

Variant names:

• chr8-60819981-AACTTTTTTTTTTCCCTTTGGTG-A
• rs886038633
• NM_017780.4:c.2614-25_2614-4delACTTTTTTTTTTCCCTTTGGTG

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_017780.4(CHD7):​c.2614-25_2614-4delACTTTTTTTTTTCCCTTTGGTG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CHD7 NM_017780.4 splice_region, intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 3.49
• Publications: 0 publications found

Genes affected

CHD7 (HGNC:20626): (chromodomain helicase DNA binding protein 7) This gene encodes a protein that contains several helicase family domains. Mutations in this gene have been found in some patients with the CHARGE syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

CHD7 Gene-Disease associations (from GenCC):

• CHARGE syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, PanelApp Australia, Broad Center for Mendelian Genomics, ClinGen, G2P
• hypogonadotropic hypogonadism 5 with or without anosmia

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• hypogonadotropic hypogonadism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Kallmann syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Omenn syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 8-60819981-AACTTTTTTTTTTCCCTTTGGTG-A is Benign according to our data. Variant chr8-60819981-AACTTTTTTTTTTCCCTTTGGTG-A is described in ClinVar as Likely_benign. ClinVar VariationId is 260896.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_017780.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHD7	NM_017780.4	MANE Select	c.2614-25_2614-4delACTTTTTTTTTTCCCTTTGGTG		splice_region intron	N/A	NP_060250.2
	CHD7	NM_001316690.1		c.1716+38932_1716+38953delACTTTTTTTTTTCCCTTTGGTG		intron	N/A	NP_001303619.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHD7	ENST00000423902.7	TSL:5 MANE Select	c.2614-25_2614-4delACTTTTTTTTTTCCCTTTGGTG		splice_region intron	N/A	ENSP00000392028.1
	CHD7	ENST00000524602.5	TSL:1	c.1716+38932_1716+38953delACTTTTTTTTTTCCCTTTGGTG		intron	N/A	ENSP00000437061.1
	CHD7	ENST00000933299.1		c.2614-25_2614-4delACTTTTTTTTTTCCCTTTGGTG		splice_region intron	N/A	ENSP00000603358.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.5
BranchPoint Hunter		6.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs886038633; hg19: chr8-61732540;